Incidental Mutation 'R4373:Esam'
ID326066
Institutional Source Beutler Lab
Gene Symbol Esam
Ensembl Gene ENSMUSG00000001946
Gene Nameendothelial cell-specific adhesion molecule
Synonyms2310008D05Rik, W117m
MMRRC Submission 041675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.111) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location37528078-37538319 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 37534196 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 71 (T71I)
Ref Sequence ENSEMBL: ENSMUSP00000122473 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002011] [ENSMUST00000123198] [ENSMUST00000144596] [ENSMUST00000146860] [ENSMUST00000214142]
Predicted Effect probably benign
Transcript: ENSMUST00000002011
AA Change: T101I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000002011
Gene: ENSMUSG00000001946
AA Change: T101I

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
IG 39 153 4.82e-6 SMART
IGc2 168 234 1.17e-4 SMART
transmembrane domain 252 274 N/A INTRINSIC
low complexity region 319 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123198
AA Change: T71I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000116300
Gene: ENSMUSG00000001946
AA Change: T71I

DomainStartEndE-ValueType
Blast:IG 9 72 1e-40 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131832
Predicted Effect probably benign
Transcript: ENSMUST00000144596
Predicted Effect probably benign
Transcript: ENSMUST00000146860
AA Change: T71I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000122473
Gene: ENSMUSG00000001946
AA Change: T71I

DomainStartEndE-ValueType
IG 9 123 4.82e-6 SMART
IGc2 138 204 1.17e-4 SMART
transmembrane domain 222 244 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000214142
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhbit a decrease in body weight, impaired neutrophil transmigration and decreased immune and VEGF-stimulated vascular permeability. Tumor growth is inhibited due to decreased pathological angiogenesis in homozygous mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Esam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03180:Esam APN 9 37534570 missense probably damaging 0.99
IGL03408:Esam APN 9 37534653 missense possibly damaging 0.52
R0755:Esam UTSW 9 37536702 missense probably damaging 0.98
R1657:Esam UTSW 9 37537621 missense probably damaging 1.00
R2349:Esam UTSW 9 37528231 missense probably benign
R3418:Esam UTSW 9 37537130 splice site probably null
R4669:Esam UTSW 9 37536656 nonsense probably null
R6175:Esam UTSW 9 37528248 missense probably benign 0.01
R6357:Esam UTSW 9 37537780 makesense probably null
R7293:Esam UTSW 9 37537724 missense probably damaging 1.00
R7472:Esam UTSW 9 37537567 missense possibly damaging 0.77
R8043:Esam UTSW 9 37537021 missense not run
Predicted Primers PCR Primer
(F):5'- ACTGCCTAGAGTTGTGAGCG -3'
(R):5'- GTGTGTCTTACTCACCCAGCAC -3'

Sequencing Primer
(F):5'- AGGTTACTAAAAGGTGGTTCAGGTC -3'
(R):5'- ACCCAGCACTTTGAGCTCTATG -3'
Posted On2015-07-06