Incidental Mutation 'R4373:Tex9'
ID326067
Institutional Source Beutler Lab
Gene Symbol Tex9
Ensembl Gene ENSMUSG00000090626
Gene Nametestis expressed gene 9
Synonymstsec-1
MMRRC Submission 041675-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.112) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location72450394-72492212 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to T at 72480595 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000138929 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085358] [ENSMUST00000085358] [ENSMUST00000085358] [ENSMUST00000085358] [ENSMUST00000183574] [ENSMUST00000183574] [ENSMUST00000183574] [ENSMUST00000183574] [ENSMUST00000183856] [ENSMUST00000183856] [ENSMUST00000184125] [ENSMUST00000184125] [ENSMUST00000184312] [ENSMUST00000184312] [ENSMUST00000184557] [ENSMUST00000184557] [ENSMUST00000184831] [ENSMUST00000184831] [ENSMUST00000184831] [ENSMUST00000184831] [ENSMUST00000185151] [ENSMUST00000185151] [ENSMUST00000185151] [ENSMUST00000185151]
Predicted Effect probably null
Transcript: ENSMUST00000085358
SMART Domains Protein: ENSMUSP00000082467
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 344 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085358
SMART Domains Protein: ENSMUSP00000082467
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 344 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085358
SMART Domains Protein: ENSMUSP00000082467
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 344 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000085358
SMART Domains Protein: ENSMUSP00000082467
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183428
Predicted Effect probably benign
Transcript: ENSMUST00000183428
Predicted Effect probably null
Transcript: ENSMUST00000183501
Predicted Effect probably null
Transcript: ENSMUST00000183501
Predicted Effect probably null
Transcript: ENSMUST00000183501
Predicted Effect probably null
Transcript: ENSMUST00000183501
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183551
Predicted Effect probably null
Transcript: ENSMUST00000183574
SMART Domains Protein: ENSMUSP00000139386
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 208 N/A INTRINSIC
coiled coil region 231 286 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183574
SMART Domains Protein: ENSMUSP00000139386
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 208 N/A INTRINSIC
coiled coil region 231 286 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183574
SMART Domains Protein: ENSMUSP00000139386
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 208 N/A INTRINSIC
coiled coil region 231 286 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000183574
SMART Domains Protein: ENSMUSP00000139386
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 208 N/A INTRINSIC
coiled coil region 231 286 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183856
SMART Domains Protein: ENSMUSP00000139247
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 328 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183856
SMART Domains Protein: ENSMUSP00000139247
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 328 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184066
Predicted Effect probably null
Transcript: ENSMUST00000184125
SMART Domains Protein: ENSMUSP00000139026
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 344 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184125
SMART Domains Protein: ENSMUSP00000139026
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184312
SMART Domains Protein: ENSMUSP00000138844
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184312
SMART Domains Protein: ENSMUSP00000138844
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184557
SMART Domains Protein: ENSMUSP00000139212
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 280 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184557
SMART Domains Protein: ENSMUSP00000139212
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 23 63 N/A INTRINSIC
coiled coil region 186 280 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184624
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184734
Predicted Effect probably null
Transcript: ENSMUST00000184831
SMART Domains Protein: ENSMUSP00000138999
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 1 159 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184831
SMART Domains Protein: ENSMUSP00000138999
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 1 159 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184831
SMART Domains Protein: ENSMUSP00000138999
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 1 159 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000184831
SMART Domains Protein: ENSMUSP00000138999
Gene: ENSMUSG00000090626

DomainStartEndE-ValueType
coiled coil region 1 159 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185106
Predicted Effect probably null
Transcript: ENSMUST00000185151
Predicted Effect probably null
Transcript: ENSMUST00000185151
Predicted Effect probably null
Transcript: ENSMUST00000185151
Predicted Effect probably null
Transcript: ENSMUST00000185151
Meta Mutation Damage Score 0.9497 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Tex9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00467:Tex9 APN 9 72477835 missense probably benign 0.32
IGL01109:Tex9 APN 9 72488067 missense probably damaging 1.00
IGL01373:Tex9 APN 9 72480754 missense possibly damaging 0.78
IGL02496:Tex9 APN 9 72482492 missense probably benign 0.25
IGL02569:Tex9 APN 9 72478363 missense probably damaging 1.00
barbacoa UTSW 9 72486778 critical splice donor site probably null
R0068:Tex9 UTSW 9 72486769 splice site probably benign
R0481:Tex9 UTSW 9 72478396 nonsense probably null
R0628:Tex9 UTSW 9 72491951 start codon destroyed probably null 0.99
R0962:Tex9 UTSW 9 72484092 missense probably benign
R2212:Tex9 UTSW 9 72477758 missense possibly damaging 0.89
R3412:Tex9 UTSW 9 72477758 missense possibly damaging 0.89
R4972:Tex9 UTSW 9 72478338 critical splice donor site probably null
R5323:Tex9 UTSW 9 72477905 missense probably damaging 1.00
R5401:Tex9 UTSW 9 72486778 critical splice donor site probably null
R6149:Tex9 UTSW 9 72462000 utr 3 prime probably null
R7396:Tex9 UTSW 9 72480790 splice site probably null
R7412:Tex9 UTSW 9 72486778 critical splice donor site probably null
X0024:Tex9 UTSW 9 72480674 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGATGGCCAACTTGCTTCATC -3'
(R):5'- TGCTCATGTATGCCCGTGTG -3'

Sequencing Primer
(F):5'- GATGGCCAACTTGCTTCATCTAGAC -3'
(R):5'- GTGCTAAACTGAAATATCCTGATGCG -3'
Posted On2015-07-06