Incidental Mutation 'R4373:Hk1'
ID 326068
Institutional Source Beutler Lab
Gene Symbol Hk1
Ensembl Gene ENSMUSG00000037012
Gene Name hexokinase 1
Synonyms mHk1-s, Hk-1, Hk1-s
MMRRC Submission 041675-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.358) question?
Stock # R4373 (G1)
Quality Score 225
Status Validated
Chromosome 10
Chromosomal Location 62268855-62379908 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to A at 62315540 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Asparagine at position 10 (K10N)
Ref Sequence ENSEMBL: ENSMUSP00000118166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072357] [ENSMUST00000099691] [ENSMUST00000116238] [ENSMUST00000130091] [ENSMUST00000130422] [ENSMUST00000132926] [ENSMUST00000133429] [ENSMUST00000134447] [ENSMUST00000134877] [ENSMUST00000135317] [ENSMUST00000136548] [ENSMUST00000139228] [ENSMUST00000143236] [ENSMUST00000140383] [ENSMUST00000152761] [ENSMUST00000154489] [ENSMUST00000143179]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000072357
AA Change: K28N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000072195
Gene: ENSMUSG00000037012
AA Change: K28N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 25 224 1.2e-70 PFAM
Pfam:Hexokinase_2 229 486 8e-79 PFAM
Pfam:Hexokinase_1 496 695 7e-76 PFAM
Pfam:Hexokinase_2 700 934 4.2e-85 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000099691
AA Change: K24N

PolyPhen 2 Score 0.628 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000097282
Gene: ENSMUSG00000037012
AA Change: K24N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 221 1.9e-86 PFAM
Pfam:Hexokinase_2 223 462 1e-102 PFAM
Pfam:Hexokinase_1 464 669 1.1e-90 PFAM
Pfam:Hexokinase_2 671 910 2.2e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000116238
AA Change: K28N

PolyPhen 2 Score 0.638 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000111946
Gene: ENSMUSG00000037012
AA Change: K28N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 21 225 1.3e-85 PFAM
Pfam:Hexokinase_2 227 357 3.6e-56 PFAM
Pfam:Hexokinase_2 362 489 9.3e-41 PFAM
Pfam:Hexokinase_1 491 696 2e-90 PFAM
Pfam:Hexokinase_2 698 937 3.8e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000130091
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000130422
AA Change: K23N

PolyPhen 2 Score 0.115 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000118601
Gene: ENSMUSG00000037012
AA Change: K23N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 16 220 1.4e-85 PFAM
Pfam:Hexokinase_2 222 461 1e-102 PFAM
Pfam:Hexokinase_1 463 668 1.1e-90 PFAM
Pfam:Hexokinase_2 670 909 2.2e-109 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000132926
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000133429
AA Change: K28N

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000134447
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000134877
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000135317
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect possibly damaging
Transcript: ENSMUST00000136548
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably damaging
Transcript: ENSMUST00000139228
AA Change: K10N

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000118166
Gene: ENSMUSG00000037012
AA Change: K10N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 3 184 1.4e-74 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000149534
AA Change: K92N
Predicted Effect possibly damaging
Transcript: ENSMUST00000143236
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142527
Predicted Effect possibly damaging
Transcript: ENSMUST00000140383
AA Change: K28N

PolyPhen 2 Score 0.905 (Sensitivity: 0.82; Specificity: 0.94)
Predicted Effect possibly damaging
Transcript: ENSMUST00000152761
AA Change: K8N

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117752
Gene: ENSMUSG00000037012
AA Change: K8N

DomainStartEndE-ValueType
Pfam:Hexokinase_1 2 205 5.6e-88 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000154489
AA Change: K28N

PolyPhen 2 Score 0.816 (Sensitivity: 0.84; Specificity: 0.93)
Predicted Effect probably benign
Transcript: ENSMUST00000143179
SMART Domains Protein: ENSMUSP00000120151
Gene: ENSMUSG00000037012

DomainStartEndE-ValueType
Pfam:Hexokinase_1 5 80 5e-29 PFAM
Meta Mutation Damage Score 0.1488 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Hexokinases phosphorylate glucose to produce glucose-6-phosphate, the first step in most glucose metabolism pathways. This gene encodes a ubiquitous form of hexokinase which localizes to the outer membrane of mitochondria. Mutations in this gene have been associated with hemolytic anemia due to hexokinase deficiency. Alternative splicing of this gene results in several transcript variants which encode different isoforms, some of which are tissue-specific. [provided by RefSeq, Apr 2016]
PHENOTYPE: Homozygous mutant mice exhibit hemolytic anemia with extensive tissue iron deposition and reticulocytosis and female infertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Hk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00493:Hk1 APN 10 62286348 nonsense probably null
IGL01108:Hk1 APN 10 62296708 missense probably benign 0.00
IGL01810:Hk1 APN 10 62353105 missense probably benign 0.13
IGL01950:Hk1 APN 10 62315394 missense probably damaging 0.99
IGL02165:Hk1 APN 10 62281888 missense probably damaging 1.00
IGL02227:Hk1 APN 10 62281140 splice site probably benign
IGL02257:Hk1 APN 10 62271643 missense probably benign 0.07
IGL02341:Hk1 APN 10 62284380 missense possibly damaging 0.54
IGL02553:Hk1 APN 10 62295773 missense possibly damaging 0.71
IGL02623:Hk1 APN 10 62292359 missense probably benign 0.21
IGL02700:Hk1 APN 10 62284811 missense probably damaging 1.00
IGL02863:Hk1 APN 10 62295755 missense possibly damaging 0.83
IGL03002:Hk1 APN 10 62271799 missense probably damaging 1.00
BB009:Hk1 UTSW 10 62315520 missense probably damaging 1.00
BB019:Hk1 UTSW 10 62315520 missense probably damaging 1.00
R0029:Hk1 UTSW 10 62315394 missense probably damaging 0.99
R0436:Hk1 UTSW 10 62299275 splice site probably benign
R0853:Hk1 UTSW 10 62271716 nonsense probably null
R1422:Hk1 UTSW 10 62296094 missense probably null 0.98
R1531:Hk1 UTSW 10 62284784 missense probably damaging 1.00
R1760:Hk1 UTSW 10 62281899 missense probably damaging 1.00
R2064:Hk1 UTSW 10 62286536 missense probably benign 0.03
R3236:Hk1 UTSW 10 62296019 splice site probably null
R3788:Hk1 UTSW 10 62275688 missense possibly damaging 0.85
R3977:Hk1 UTSW 10 62290319 missense probably benign 0.10
R4374:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4377:Hk1 UTSW 10 62315540 missense probably damaging 0.98
R4435:Hk1 UTSW 10 62275844 missense probably damaging 1.00
R4609:Hk1 UTSW 10 62358415 utr 5 prime probably benign
R4648:Hk1 UTSW 10 62304779 missense probably benign 0.00
R4864:Hk1 UTSW 10 62342539 missense probably benign 0.00
R4934:Hk1 UTSW 10 62358386 utr 5 prime probably benign
R5110:Hk1 UTSW 10 62286651 missense probably damaging 1.00
R5352:Hk1 UTSW 10 62304770 missense probably damaging 0.97
R5569:Hk1 UTSW 10 62286441 missense probably benign 0.35
R5609:Hk1 UTSW 10 62342551 missense probably benign 0.30
R5647:Hk1 UTSW 10 62275744 missense probably damaging 0.99
R5750:Hk1 UTSW 10 62274466 missense possibly damaging 0.86
R5770:Hk1 UTSW 10 62286449 missense probably benign
R5832:Hk1 UTSW 10 62292365 missense probably benign 0.17
R5905:Hk1 UTSW 10 62353058 missense probably null 0.82
R5933:Hk1 UTSW 10 62269994 missense probably damaging 1.00
R6028:Hk1 UTSW 10 62353058 missense probably null 0.82
R6196:Hk1 UTSW 10 62299259 missense probably damaging 1.00
R6314:Hk1 UTSW 10 62292444 missense possibly damaging 0.93
R6372:Hk1 UTSW 10 62291978 missense probably benign
R6801:Hk1 UTSW 10 62281131 missense probably damaging 0.97
R6838:Hk1 UTSW 10 62271658 missense probably damaging 0.98
R7045:Hk1 UTSW 10 62286570 missense probably damaging 1.00
R7420:Hk1 UTSW 10 62269982 missense probably damaging 1.00
R7491:Hk1 UTSW 10 62295745 missense probably damaging 1.00
R7527:Hk1 UTSW 10 62304782 missense probably damaging 0.99
R7561:Hk1 UTSW 10 62281028 splice site probably null
R7932:Hk1 UTSW 10 62315520 missense probably damaging 1.00
R8031:Hk1 UTSW 10 62296699 missense probably benign 0.15
R8128:Hk1 UTSW 10 62281843 missense probably benign
R8204:Hk1 UTSW 10 62296744 missense probably damaging 1.00
R8294:Hk1 UTSW 10 62295845 missense probably benign 0.00
R8685:Hk1 UTSW 10 62296674 splice site probably benign
R8865:Hk1 UTSW 10 62315515 missense probably benign 0.00
R9015:Hk1 UTSW 10 62292339 missense possibly damaging 0.95
R9022:Hk1 UTSW 10 62269989 missense probably damaging 1.00
R9063:Hk1 UTSW 10 62286650 missense probably damaging 1.00
R9404:Hk1 UTSW 10 62296080 missense possibly damaging 0.76
X0018:Hk1 UTSW 10 62275706 missense probably benign 0.02
X0063:Hk1 UTSW 10 62275704 nonsense probably null
Predicted Primers PCR Primer
(F):5'- ATCTGTTGGAAAGACAGGTTTCAC -3'
(R):5'- GAGTCAACAGCCTTCTCTGG -3'

Sequencing Primer
(F):5'- GGTTTCACAGAGCATTCAGC -3'
(R):5'- ACAGCCTTCTCTGGTGCCATG -3'
Posted On 2015-07-06