Incidental Mutation 'R4373:Nmt1'
ID 326070
Institutional Source Beutler Lab
Gene Symbol Nmt1
Ensembl Gene ENSMUSG00000020936
Gene Name N-myristoyltransferase 1
Synonyms
MMRRC Submission 041675-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R4373 (G1)
Quality Score 225
Status Validated
Chromosome 11
Chromosomal Location 103028190-103068912 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 103043200 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Lysine to Arginine at position 55 (K55R)
Ref Sequence ENSEMBL: ENSMUSP00000021314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021314]
AlphaFold O70310
Predicted Effect probably damaging
Transcript: ENSMUST00000021314
AA Change: K55R

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000021314
Gene: ENSMUSG00000020936
AA Change: K55R

DomainStartEndE-ValueType
low complexity region 55 67 N/A INTRINSIC
Pfam:NMT 137 294 6.7e-77 PFAM
Pfam:NMT_C 308 495 1.4e-85 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135332
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148795
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181125
Meta Mutation Damage Score 0.0699 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myristate, a rare 14-carbon saturated fatty acid, is cotranslationally attached by an amide linkage to the N-terminal glycine residue of cellular and viral proteins with diverse functions. N-myristoyltransferase (NMT; EC 2.3.1.97) catalyzes the transfer of myristate from CoA to proteins. N-myristoylation appears to be irreversible and is required for full expression of the biologic activities of several N-myristoylated proteins, including the alpha subunit of the signal-transducing guanine nucleotide-binding protein (G protein) GO (GNAO1; MIM 139311) (Duronio et al., 1992 [PubMed 1570339]).[supplied by OMIM, Nov 2008]
PHENOTYPE: Homozygous mutation of this gene results in embryonic lethality between E3.5 and E7.5. Heterozygotes show partial prenatal lethality. Mice homozygous for a conditional allele knocked out in T cells exhibit reduced T cell, double positive T cell and single positive T cell numbers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Nmt1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00929:Nmt1 APN 11 103060076 critical splice acceptor site probably null
IGL02058:Nmt1 APN 11 103052290 missense probably benign 0.00
IGL02582:Nmt1 APN 11 103064799 missense possibly damaging 0.94
cropped UTSW 11 103056459 missense probably damaging 1.00
R0092:Nmt1 UTSW 11 103046493 missense probably damaging 1.00
R1401:Nmt1 UTSW 11 103057481 missense probably damaging 0.99
R1827:Nmt1 UTSW 11 103064838 missense probably damaging 1.00
R1878:Nmt1 UTSW 11 103052251 missense probably benign
R2199:Nmt1 UTSW 11 103063856 missense probably damaging 1.00
R3930:Nmt1 UTSW 11 103052233 missense probably benign 0.37
R4648:Nmt1 UTSW 11 103063917 missense probably damaging 1.00
R5666:Nmt1 UTSW 11 103058215 nonsense probably null
R6908:Nmt1 UTSW 11 103058254 missense possibly damaging 0.92
R7315:Nmt1 UTSW 11 103060183 missense probably benign
R7473:Nmt1 UTSW 11 103046400 missense probably benign 0.05
R7504:Nmt1 UTSW 11 103056459 missense probably damaging 1.00
R8548:Nmt1 UTSW 11 103043226 missense possibly damaging 0.80
R8913:Nmt1 UTSW 11 103057445 missense probably damaging 1.00
X0018:Nmt1 UTSW 11 103028586 missense probably benign 0.01
Z1177:Nmt1 UTSW 11 103055213 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- GGAGCTGGATTCTCTAGTCTGC -3'
(R):5'- TACCGAGCACAGTTTCATCAAC -3'

Sequencing Primer
(F):5'- CTTCTGAAGCAGCCAACAGACTTG -3'
(R):5'- GTTTCATCAACAAAGTCTAAGGCAC -3'
Posted On 2015-07-06