Mutagenetix > Incidental Mutation

Incidental Mutation 'R4373:Xpo4'

326075

Institutional Source

Beutler Lab

Gene Symbol

Xpo4

Ensembl Gene

ENSMUSG00000021952

Gene Name

exportin 4

Synonyms

MMRRC Submission

041675-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.841) question?

Stock #

R4373 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

57577521-57665430 bp(-) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

G to A at 57591022 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 794 (Q794*)

Ref Sequence

ENSEMBL: ENSMUSP00000133280 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174545]

AlphaFold

Q9ESJ0

Predicted Effect

probably null
Transcript: ENSMUST00000089482
AA Change: Q794*

SMART Domains

Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: Q794*

Domain	Start	End	E-Value	Type
Blast:IBN_N	37	103	8e-19	BLAST
low complexity region	165	174	N/A	INTRINSIC
low complexity region	459	468	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
Pfam:CRM1_C	954	1144	6.3e-8	PFAM

Predicted Effect

probably null
Transcript: ENSMUST00000174545
AA Change: Q794*

SMART Domains

Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: Q794*

Domain	Start	End	E-Value	Type
Blast:IBN_N	37	103	8e-19	BLAST
low complexity region	165	174	N/A	INTRINSIC
low complexity region	459	468	N/A	INTRINSIC
low complexity region	506	517	N/A	INTRINSIC
low complexity region	911	922	N/A	INTRINSIC
Pfam:CRM1_C	952	1143	5.2e-9	PFAM

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,265		probably null	Het
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Akr1b3	A	C	6: 34,304,267		probably benign	Het
Asns	A	T	6: 7,677,978	S367T	probably damaging	Het
BC034090	T	C	1: 155,226,158	N120S	probably benign	Het
Bub1	A	T	2: 127,805,236		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Ctsz	T	C	2: 174,428,585	E268G	possibly damaging	Het
Dach1	G	A	14: 97,827,750	T685I	possibly damaging	Het
Dclre1a	A	G	19: 56,545,442	L240S	probably benign	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Esam	C	T	9: 37,534,196	T71I	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Gde1	A	G	7: 118,698,558	L35P	possibly damaging	Het
Gm10382	A	G	5: 125,389,583		probably benign	Het
H2-M10.6	T	C	17: 36,813,066	Y141H	probably damaging	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Lamc3	A	G	2: 31,898,232	K135E	probably damaging	Het
Lrtm2	A	G	6: 119,320,528	F184S	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Mtcl1	T	A	17: 66,380,079	T611S	probably benign	Het
Myc	A	T	15: 61,989,664	H373L	probably damaging	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naaa	T	C	5: 92,278,143		probably benign	Het
Nfib	A	G	4: 82,323,658	V432A	probably damaging	Het
Nmt1	A	G	11: 103,043,200	K55R	probably damaging	Het
Olfr1228	T	C	2: 89,249,245	R150G	possibly damaging	Het
Opa3	C	T	7: 19,244,774	R55W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Pld5	T	A	1: 176,140,017	I91F	probably damaging	Het
Plec	A	C	15: 76,183,117	S1350A	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,765	Y537H	probably damaging	Het
Prdm8	T	C	5: 98,186,508	S645P	probably damaging	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Sgsm1	TTTTATATT	TTT	5: 113,258,123		probably benign	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Stat4	T	C	1: 52,071,941		probably null	Het
Tex9	A	T	9: 72,480,595		probably null	Het
Tsku	T	C	7: 98,352,831	T98A	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r116	A	C	17: 23,401,421	I710L	probably benign	Het
Vmn2r16	A	T	5: 109,363,801	I625F	probably damaging	Het
Zfp112	T	A	7: 24,125,048	I147N	probably damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Xpo4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01944:Xpo4	APN	14	57604398	missense	probably benign
IGL02537:Xpo4	APN	14	57593833	missense	probably benign
IGL02554:Xpo4	APN	14	57590088	missense	probably benign	0.00
IGL02826:Xpo4	APN	14	57629420	missense	possibly damaging	0.50
IGL03071:Xpo4	APN	14	57618228	missense	possibly damaging	0.66
PIT4131001:Xpo4	UTSW	14	57584611	missense	probably null	0.98
R0245:Xpo4	UTSW	14	57630240	missense	probably damaging	1.00
R0546:Xpo4	UTSW	14	57613274	missense	probably benign	0.07
R0606:Xpo4	UTSW	14	57638208	unclassified	probably benign
R0761:Xpo4	UTSW	14	57613383	missense	probably damaging	0.99
R1775:Xpo4	UTSW	14	57603672	missense	probably benign
R1853:Xpo4	UTSW	14	57585907	missense	possibly damaging	0.72
R1923:Xpo4	UTSW	14	57590871	missense	probably damaging	0.98
R2007:Xpo4	UTSW	14	57586644	missense	probably null	0.19
R2035:Xpo4	UTSW	14	57585926	missense	possibly damaging	0.57
R2174:Xpo4	UTSW	14	57590090	missense	probably damaging	1.00
R2421:Xpo4	UTSW	14	57629503	missense	probably benign	0.00
R2937:Xpo4	UTSW	14	57604440	missense	probably benign	0.03
R2938:Xpo4	UTSW	14	57604440	missense	probably benign	0.03
R4066:Xpo4	UTSW	14	57588054	missense	probably benign	0.07
R4086:Xpo4	UTSW	14	57643033	intron	probably benign
R4620:Xpo4	UTSW	14	57630325	missense	probably damaging	1.00
R4703:Xpo4	UTSW	14	57590108	missense	probably benign	0.01
R4755:Xpo4	UTSW	14	57618181	missense	probably benign	0.01
R4831:Xpo4	UTSW	14	57590102	missense	probably damaging	1.00
R4905:Xpo4	UTSW	14	57638289	missense	possibly damaging	0.70
R4943:Xpo4	UTSW	14	57638240	missense	possibly damaging	0.68
R5074:Xpo4	UTSW	14	57584641	missense	probably benign	0.02
R5279:Xpo4	UTSW	14	57613409	missense	probably benign	0.37
R5375:Xpo4	UTSW	14	57638307	missense	probably damaging	0.99
R5690:Xpo4	UTSW	14	57590989	missense	probably benign	0.03
R5936:Xpo4	UTSW	14	57643499	missense	probably benign
R6393:Xpo4	UTSW	14	57638313	missense	probably damaging	1.00
R6824:Xpo4	UTSW	14	57613403	missense	probably damaging	1.00
R6893:Xpo4	UTSW	14	57582310	missense	probably benign
R6923:Xpo4	UTSW	14	57603711	missense	probably benign	0.19
R7028:Xpo4	UTSW	14	57597051	missense	probably benign	0.22
R7442:Xpo4	UTSW	14	57630223	missense	probably benign	0.00
R7469:Xpo4	UTSW	14	57597979	missense	probably benign
R7490:Xpo4	UTSW	14	57602621	frame shift	probably null
R7622:Xpo4	UTSW	14	57597011	missense	possibly damaging	0.94
R7667:Xpo4	UTSW	14	57589959	missense	probably damaging	0.97
R7789:Xpo4	UTSW	14	57613349	missense	probably benign	0.00
R7895:Xpo4	UTSW	14	57602591	missense	probably benign	0.03
R8000:Xpo4	UTSW	14	57589946	missense	probably damaging	1.00
R8372:Xpo4	UTSW	14	57597884	critical splice donor site	probably null
R8395:Xpo4	UTSW	14	57648467	missense	probably benign	0.01
R8420:Xpo4	UTSW	14	57604456	missense	probably damaging	0.99
R8836:Xpo4	UTSW	14	57664910	missense	probably benign	0.03
R8841:Xpo4	UTSW	14	57597956	missense	probably damaging	0.97
R8989:Xpo4	UTSW	14	57591018	missense	probably benign	0.00
R9229:Xpo4	UTSW	14	57613699	missense	probably benign
R9374:Xpo4	UTSW	14	57591055	missense	possibly damaging	0.94
R9551:Xpo4	UTSW	14	57591055	missense	possibly damaging	0.94
R9628:Xpo4	UTSW	14	57605173	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTTCAGAGATTTGTAATCCTGAC -3'
(R):5'- AGGGATAAAGAGCTTACTGGTTC -3'

Sequencing Primer
(F):5'- CTTACCTCTCCAAGATAGCATATTTG -3'
(R):5'- GAGCTTACTGGTTCAAATAGTCCTTG -3'

Posted On

2015-07-06