Incidental Mutation 'R4373:Xpo4'
ID326075
Institutional Source Beutler Lab
Gene Symbol Xpo4
Ensembl Gene ENSMUSG00000021952
Gene Nameexportin 4
Synonyms
MMRRC Submission 041675-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.650) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location57577521-57665430 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) G to A at 57591022 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 794 (Q794*)
Ref Sequence ENSEMBL: ENSMUSP00000133280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000089482] [ENSMUST00000174545]
Predicted Effect probably null
Transcript: ENSMUST00000089482
AA Change: Q794*
SMART Domains Protein: ENSMUSP00000086909
Gene: ENSMUSG00000021952
AA Change: Q794*

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 954 1144 6.3e-8 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000174545
AA Change: Q794*
SMART Domains Protein: ENSMUSP00000133280
Gene: ENSMUSG00000021952
AA Change: Q794*

DomainStartEndE-ValueType
Blast:IBN_N 37 103 8e-19 BLAST
low complexity region 165 174 N/A INTRINSIC
low complexity region 459 468 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 911 922 N/A INTRINSIC
Pfam:CRM1_C 952 1143 5.2e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] XPO4 belongs to a large family of karyopherins (see MIM 602738) that mediate the transport of proteins and other cargo between the nuclear and cytoplasmic compartments (Lipowsky et al., 2000 [PubMed 10944119]).[supplied by OMIM, Mar 2009]
PHENOTYPE: Mice homozygous for a gene trapped allele appear phenotypically normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Xpo4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01944:Xpo4 APN 14 57604398 missense probably benign
IGL02537:Xpo4 APN 14 57593833 missense probably benign
IGL02554:Xpo4 APN 14 57590088 missense probably benign 0.00
IGL02826:Xpo4 APN 14 57629420 missense possibly damaging 0.50
IGL03071:Xpo4 APN 14 57618228 missense possibly damaging 0.66
PIT4131001:Xpo4 UTSW 14 57584611 missense probably null 0.98
R0245:Xpo4 UTSW 14 57630240 missense probably damaging 1.00
R0546:Xpo4 UTSW 14 57613274 missense probably benign 0.07
R0606:Xpo4 UTSW 14 57638208 unclassified probably benign
R0761:Xpo4 UTSW 14 57613383 missense probably damaging 0.99
R1775:Xpo4 UTSW 14 57603672 missense probably benign
R1853:Xpo4 UTSW 14 57585907 missense possibly damaging 0.72
R1923:Xpo4 UTSW 14 57590871 missense probably damaging 0.98
R2007:Xpo4 UTSW 14 57586644 missense probably null 0.19
R2035:Xpo4 UTSW 14 57585926 missense possibly damaging 0.57
R2174:Xpo4 UTSW 14 57590090 missense probably damaging 1.00
R2421:Xpo4 UTSW 14 57629503 missense probably benign 0.00
R2937:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R2938:Xpo4 UTSW 14 57604440 missense probably benign 0.03
R4066:Xpo4 UTSW 14 57588054 missense probably benign 0.07
R4086:Xpo4 UTSW 14 57643033 intron probably benign
R4620:Xpo4 UTSW 14 57630325 missense probably damaging 1.00
R4703:Xpo4 UTSW 14 57590108 missense probably benign 0.01
R4755:Xpo4 UTSW 14 57618181 missense probably benign 0.01
R4831:Xpo4 UTSW 14 57590102 missense probably damaging 1.00
R4905:Xpo4 UTSW 14 57638289 missense possibly damaging 0.70
R4943:Xpo4 UTSW 14 57638240 missense possibly damaging 0.68
R5074:Xpo4 UTSW 14 57584641 missense probably benign 0.02
R5279:Xpo4 UTSW 14 57613409 missense probably benign 0.37
R5375:Xpo4 UTSW 14 57638307 missense probably damaging 0.99
R5690:Xpo4 UTSW 14 57590989 missense probably benign 0.03
R5936:Xpo4 UTSW 14 57643499 missense probably benign
R6393:Xpo4 UTSW 14 57638313 missense probably damaging 1.00
R6824:Xpo4 UTSW 14 57613403 missense probably damaging 1.00
R6893:Xpo4 UTSW 14 57582310 missense probably benign
R6923:Xpo4 UTSW 14 57603711 missense probably benign 0.19
R7028:Xpo4 UTSW 14 57597051 missense probably benign 0.22
R7442:Xpo4 UTSW 14 57630223 missense probably benign 0.00
R7469:Xpo4 UTSW 14 57597979 missense probably benign
R7490:Xpo4 UTSW 14 57602621 frame shift probably null
R7622:Xpo4 UTSW 14 57597011 missense possibly damaging 0.94
R7667:Xpo4 UTSW 14 57589959 missense probably damaging 0.97
R7789:Xpo4 UTSW 14 57613349 missense probably benign 0.00
R7895:Xpo4 UTSW 14 57602591 missense probably benign 0.03
R7978:Xpo4 UTSW 14 57602591 missense probably benign 0.03
R8000:Xpo4 UTSW 14 57589946 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTCAGAGATTTGTAATCCTGAC -3'
(R):5'- AGGGATAAAGAGCTTACTGGTTC -3'

Sequencing Primer
(F):5'- CTTACCTCTCCAAGATAGCATATTTG -3'
(R):5'- GAGCTTACTGGTTCAAATAGTCCTTG -3'
Posted On2015-07-06