Mutagenetix > Incidental Mutations

Incidental Mutation 'R4373:Dach1'

326076

Institutional Source

Beutler Lab

Gene Symbol

Dach1

Ensembl Gene

ENSMUSG00000055639

Gene Name

dachshund family transcription factor 1

Synonyms

Dac, E130112M23Rik

MMRRC Submission

041675-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4373 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

97786853-98169765 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 97827750 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Isoleucine at position 685 (T685I)

Ref Sequence

ENSEMBL: ENSMUSP00000064970 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069334] [ENSMUST00000071533]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000069334
AA Change: T685I

PolyPhen 2 Score 0.935 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000064970
Gene: ENSMUSG00000055639
AA Change: T685I

Domain	Start	End	E-Value	Type
low complexity region	7	53	N/A	INTRINSIC
low complexity region	61	97	N/A	INTRINSIC
low complexity region	102	156	N/A	INTRINSIC
Pfam:Ski_Sno	159	275	4.8e-53	PFAM
low complexity region	318	334	N/A	INTRINSIC
low complexity region	443	470	N/A	INTRINSIC
SCOP:d1eq1a_	556	674	1e-3	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000071533
AA Change: T737I

PolyPhen 2 Score 0.920 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000071464
Gene: ENSMUSG00000055639
AA Change: T737I

Domain	Start	End	E-Value	Type
low complexity region	7	53	N/A	INTRINSIC
low complexity region	61	97	N/A	INTRINSIC
low complexity region	102	156	N/A	INTRINSIC
Pfam:Ski_Sno	164	274	6.5e-42	PFAM
low complexity region	318	334	N/A	INTRINSIC
low complexity region	495	522	N/A	INTRINSIC
SCOP:d1eq1a_	608	726	6e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000156684

Meta Mutation Damage Score

0.1615

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a chromatin-associated protein that associates with other DNA-binding transcription factors to regulate gene expression and cell fate determination during development. The protein contains a Ski domain that is highly conserved from Drosophila to human. Expression of this gene is lost in some forms of metastatic cancer, and is correlated with poor prognosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2009]
PHENOTYPE: In spite of normal gross morphology, mice homozygous for targeted mutations that inactivate this gene die within 1 day of birth. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,265		probably null	Het
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Akr1b3	A	C	6: 34,304,267		probably benign	Het
Asns	A	T	6: 7,677,978	S367T	probably damaging	Het
BC034090	T	C	1: 155,226,158	N120S	probably benign	Het
Bub1	A	T	2: 127,805,236		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Ctsz	T	C	2: 174,428,585	E268G	possibly damaging	Het
Dclre1a	A	G	19: 56,545,442	L240S	probably benign	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Esam	C	T	9: 37,534,196	T71I	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Gde1	A	G	7: 118,698,558	L35P	possibly damaging	Het
Gm10382	A	G	5: 125,389,583		probably benign	Het
H2-M10.6	T	C	17: 36,813,066	Y141H	probably damaging	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Lamc3	A	G	2: 31,898,232	K135E	probably damaging	Het
Lrtm2	A	G	6: 119,320,528	F184S	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Mtcl1	T	A	17: 66,380,079	T611S	probably benign	Het
Myc	A	T	15: 61,989,664	H373L	probably damaging	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naaa	T	C	5: 92,278,143		probably benign	Het
Nfib	A	G	4: 82,323,658	V432A	probably damaging	Het
Nmt1	A	G	11: 103,043,200	K55R	probably damaging	Het
Olfr1228	T	C	2: 89,249,245	R150G	possibly damaging	Het
Opa3	C	T	7: 19,244,774	R55W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Pld5	T	A	1: 176,140,017	I91F	probably damaging	Het
Plec	A	C	15: 76,183,117	S1350A	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,765	Y537H	probably damaging	Het
Prdm8	T	C	5: 98,186,508	S645P	probably damaging	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Sgsm1	TTTTATATT	TTT	5: 113,258,123		probably benign	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Stat4	T	C	1: 52,071,941		probably null	Het
Tex9	A	T	9: 72,480,595		probably null	Het
Tsku	T	C	7: 98,352,831	T98A	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r116	A	C	17: 23,401,421	I710L	probably benign	Het
Vmn2r16	A	T	5: 109,363,801	I625F	probably damaging	Het
Xpo4	G	A	14: 57,591,022	Q794*	probably null	Het
Zfp112	T	A	7: 24,125,048	I147N	probably damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Dach1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00780:Dach1	APN	14	97901422	missense	possibly damaging	0.83
IGL01101:Dach1	APN	14	97840204	missense	possibly damaging	0.83
IGL02033:Dach1	APN	14	97901429	missense	possibly damaging	0.82
IGL02116:Dach1	APN	14	97901423	missense	probably damaging	0.98
IGL02583:Dach1	APN	14	97828394	splice site	probably benign
IGL02937:Dach1	APN	14	97915795	critical splice donor site	probably null
IGL03120:Dach1	APN	14	97827789	missense	probably damaging	1.00
R0016:Dach1	UTSW	14	98168748	missense	probably damaging	1.00
R0017:Dach1	UTSW	14	98168748	missense	probably damaging	1.00
R0117:Dach1	UTSW	14	98168748	missense	probably damaging	1.00
R0334:Dach1	UTSW	14	98168748	missense	probably damaging	1.00
R0336:Dach1	UTSW	14	98168748	missense	probably damaging	1.00
R0371:Dach1	UTSW	14	97969903	missense	probably damaging	0.99
R0511:Dach1	UTSW	14	97901329	missense	possibly damaging	0.94
R0538:Dach1	UTSW	14	97903279	missense	possibly damaging	0.80
R0799:Dach1	UTSW	14	98168615	missense	possibly damaging	0.79
R0928:Dach1	UTSW	14	97915832	missense	probably damaging	0.98
R0939:Dach1	UTSW	14	97915924	missense	probably damaging	0.99
R1512:Dach1	UTSW	14	97901399	missense	probably damaging	0.99
R1646:Dach1	UTSW	14	98169114	missense	unknown
R1865:Dach1	UTSW	14	97840209	missense	possibly damaging	0.68
R1881:Dach1	UTSW	14	97901396	missense	probably benign	0.20
R1909:Dach1	UTSW	14	97901393	missense	probably damaging	1.00
R1980:Dach1	UTSW	14	97831341	missense	probably damaging	1.00
R2215:Dach1	UTSW	14	98168481	critical splice donor site	probably null
R2570:Dach1	UTSW	14	97901411	missense	probably benign	0.17
R3924:Dach1	UTSW	14	97915903	missense	probably damaging	1.00
R3957:Dach1	UTSW	14	97840109	missense	probably damaging	0.99
R4095:Dach1	UTSW	14	97901379	missense	possibly damaging	0.92
R5350:Dach1	UTSW	14	97969959	missense	probably damaging	1.00
R5428:Dach1	UTSW	14	98169269	missense	unknown
R5818:Dach1	UTSW	14	98168684	missense	probably damaging	1.00
R6824:Dach1	UTSW	14	98018892	missense	possibly damaging	0.81
R6967:Dach1	UTSW	14	97903197	missense	probably damaging	1.00
R7263:Dach1	UTSW	14	98168859	missense	probably benign
R7701:Dach1	UTSW	14	97903234	missense	probably damaging	0.99
R8176:Dach1	UTSW	14	97916480	missense	probably benign	0.02
R8196:Dach1	UTSW	14	98018934	missense	probably damaging	0.98
R8419:Dach1	UTSW	14	98168640	missense	probably damaging	1.00
R8434:Dach1	UTSW	14	98168693	missense	probably damaging	1.00
R8510:Dach1	UTSW	14	97903159	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CTGCCAGAATTAGATTGTGCTTC -3'
(R):5'- GAGGAGACTTACGTGGTTTTAATTC -3'

Sequencing Primer
(F):5'- CCAGAATTAGATTGTGCTTCGAACAC -3'
(R):5'- CTGTATCAAGTGAACAGGTAGCTC -3'

Posted On

2015-07-06