Incidental Mutation 'R4373:March11'
ID 326079
Institutional Source Beutler Lab
Gene Symbol March11
Ensembl Gene ENSMUSG00000022269
Gene Name membrane-associated ring finger (C3HC4) 11
Synonyms
MMRRC Submission 041675-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.353) question?
Stock # R4373 (G1)
Quality Score 139
Status Validated
Chromosome 15
Chromosomal Location 26309048-26409576 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 26309446 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 62 (E62G)
Ref Sequence ENSEMBL: ENSMUSP00000120622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126304] [ENSMUST00000140840] [ENSMUST00000152841]
AlphaFold Q8CBH7
Predicted Effect probably benign
Transcript: ENSMUST00000126304
AA Change: E62G

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
Predicted Effect probably benign
Transcript: ENSMUST00000140840
AA Change: E62G

PolyPhen 2 Score 0.399 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000118729
Gene: ENSMUSG00000022269
AA Change: E62G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 73 83 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
RINGv 167 214 4.81e-16 SMART
transmembrane domain 244 266 N/A INTRINSIC
Blast:AAA 269 296 6e-7 BLAST
low complexity region 329 341 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000152841
AA Change: E62G

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000120622
Gene: ENSMUSG00000022269
AA Change: E62G

DomainStartEndE-ValueType
low complexity region 19 30 N/A INTRINSIC
low complexity region 73 83 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
RINGv 167 214 4.81e-16 SMART
Meta Mutation Damage Score 0.1361 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH11 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). These enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their intracellular transport. March11 appears to have a role in ubiquitin-mediated protein sorting in the trans-Golgi network (TGN)-multivesicular body (MVB) transport pathway (Morokuma et al., 2007 [PubMed 17604280]).[supplied by OMIM, Apr 2010]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in March11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01618:March11 APN 15 26409199 missense possibly damaging 0.93
IGL03079:March11 APN 15 26311058 missense probably damaging 1.00
R0625:March11 UTSW 15 26311043 missense probably damaging 0.99
R1055:March11 UTSW 15 26309662 missense probably damaging 0.99
R1116:March11 UTSW 15 26409295 missense probably damaging 1.00
R1851:March11 UTSW 15 26387830 missense probably damaging 1.00
R3862:March11 UTSW 15 26387866 missense probably damaging 1.00
R3863:March11 UTSW 15 26387866 missense probably damaging 1.00
R3864:March11 UTSW 15 26387866 missense probably damaging 1.00
R4375:March11 UTSW 15 26309446 missense probably damaging 0.96
R4376:March11 UTSW 15 26309446 missense probably damaging 0.96
R4580:March11 UTSW 15 26311103 missense probably damaging 1.00
R6284:March11 UTSW 15 26409346 missense probably benign 0.36
R6710:March11 UTSW 15 26387863 missense probably damaging 1.00
R7490:March11 UTSW 15 26311101 missense possibly damaging 0.88
R7748:March11 UTSW 15 26387830 missense probably damaging 0.98
R7794:March11 UTSW 15 26409198 missense probably benign 0.09
R7937:March11 UTSW 15 26409237 missense probably damaging 0.99
R7942:March11 UTSW 15 26409419 makesense probably null
X0063:March11 UTSW 15 26387893 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTCCAGTGCTTGTTCCCAG -3'
(R):5'- ACATACGGAGCGTGTTTCGG -3'

Sequencing Primer
(F):5'- TCCACCATGAGCGACGAG -3'
(R):5'- CTGGTCTCCGGTGCCTC -3'
Posted On 2015-07-06