Mutagenetix > Incidental Mutation

Incidental Mutation 'R0013:Notch1'

32608

Institutional Source

Beutler Lab

Gene Symbol

Notch1

Ensembl Gene

ENSMUSG00000026923

Gene Name

notch 1

Synonyms

Tan1, 9930111A19Rik, Mis6, Motch A, lin-12, N1

MMRRC Submission

038308-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R0013 (G1)

Quality Score

192

Status

Not validated

Chromosome

Chromosomal Location

26457903-26516663 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 26473818 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 868 (V868A)

Ref Sequence

ENSEMBL: ENSMUSP00000028288 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028288] [ENSMUST00000132820]

AlphaFold

Q01705

PDB Structure

The Crystal Structure of a Partial Mouse Notch-1 Ankyrin Domain: Repeats 4 Through 7 Preserve an Ankyrin Fold [X-RAY DIFFRACTION]
Mouse Notch 1 Ankyrin Repeat Intracellular Domain [X-RAY DIFFRACTION]
Structure of sugar modified epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Structure of O-fucosylated epidermal growth factor-like repeat 12 of mouse Notch-1 receptor [SOLUTION NMR]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1930-1949) peptide [X-RAY DIFFRACTION]
Factor inhibiting HIF-1 Alpha in complex with Notch 1 fragment mouse notch (1997-2016) peptide [X-RAY DIFFRACTION]

Predicted Effect

possibly damaging
Transcript: ENSMUST00000028288
AA Change: V868A

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000028288
Gene: ENSMUSG00000026923
AA Change: V868A

Domain	Start	End	E-Value	Type
signal peptide	1	18	N/A	INTRINSIC
EGF	23	58	1.63e1	SMART
EGF	62	99	4.29e-5	SMART
EGF	105	139	6.25e-7	SMART
EGF_CA	140	176	1.02e-6	SMART
EGF_CA	178	216	4.21e-13	SMART
EGF	221	255	6.7e-7	SMART
EGF_CA	257	293	6.8e-8	SMART
EGF_CA	295	333	1.16e-10	SMART
EGF_CA	335	371	3.17e-8	SMART
EGF	375	410	5.32e-1	SMART
EGF_CA	412	450	4.59e-14	SMART
EGF_CA	452	488	1.02e-11	SMART
EGF_CA	490	526	4.81e-8	SMART
EGF_CA	528	564	3.19e-13	SMART
EGF_CA	566	601	1.91e-11	SMART
EGF_CA	603	639	1.78e-11	SMART
EGF_CA	641	676	9.62e-8	SMART
EGF_CA	678	714	2.38e-12	SMART
EGF_CA	716	751	5.23e-9	SMART
EGF_CA	753	789	6.25e-7	SMART
EGF_CA	791	827	1.1e-11	SMART
EGF	832	867	2.03e-6	SMART
EGF_CA	869	905	5.73e-15	SMART
EGF_CA	907	943	4.56e-9	SMART
EGF_CA	945	981	1.64e-10	SMART
EGF_CA	983	1019	5.83e-7	SMART
EGF_CA	1021	1057	1.05e-13	SMART
EGF	1062	1095	8.12e-6	SMART
EGF	1100	1143	5.66e-5	SMART
EGF_CA	1145	1181	1.1e-11	SMART
EGF_CA	1183	1219	3.87e-12	SMART
EGF_CA	1221	1265	2.89e-11	SMART
EGF_CA	1267	1305	1.2e-8	SMART
EGF	1310	1346	5.74e-6	SMART
EGF	1351	1384	4.1e-2	SMART
EGF	1390	1426	2.66e-1	SMART
NL	1442	1480	4.08e-16	SMART
NL	1483	1522	1.08e-15	SMART
NL	1523	1562	7.39e-14	SMART
NOD	1566	1622	1.81e-32	SMART
NODP	1660	1722	3.27e-30	SMART
low complexity region	1729	1746	N/A	INTRINSIC
ANK	1870	1912	1.07e2	SMART
ANK	1917	1946	4.82e-3	SMART
ANK	1950	1980	6.71e-2	SMART
ANK	1984	2013	1.23e0	SMART
ANK	2017	2046	9.13e-4	SMART
ANK	2050	2079	2.97e-3	SMART
low complexity region	2205	2222	N/A	INTRINSIC
low complexity region	2364	2395	N/A	INTRINSIC
DUF3454	2453	2517	2.01e-30	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000123873

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129506

Predicted Effect

probably benign
Transcript: ENSMUST00000132820

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000183922

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.8%

Validation Efficiency

94% (79/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the NOTCH family of proteins. Members of this Type I transmembrane protein family share structural characteristics including an extracellular domain consisting of multiple epidermal growth factor-like (EGF) repeats, and an intracellular domain consisting of multiple different domain types. Notch signaling is an evolutionarily conserved intercellular signaling pathway that regulates interactions between physically adjacent cells through binding of Notch family receptors to their cognate ligands. The encoded preproprotein is proteolytically processed in the trans-Golgi network to generate two polypeptide chains that heterodimerize to form the mature cell-surface receptor. This receptor plays a role in the development of numerous cell and tissue types. Mutations in this gene are associated with aortic valve disease, Adams-Oliver syndrome, T-cell acute lymphoblastic leukemia, chronic lymphocytic leukemia, and head and neck squamous cell carcinoma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygotes for null alleles exhibit defects in embryonic development resulting in lethality at some point in organogenesis. Lethal phenotype may be affected by genetic background. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	G	10: 76,457,512	M156V	probably benign	Het
Adnp2	A	T	18: 80,129,745	V483D	probably damaging	Het
Aff1	G	T	5: 103,828,484	E491*	probably null	Het
Agl	A	T	3: 116,776,608	C911*	probably null	Het
Akt2	A	G	7: 27,636,058	D284G	probably damaging	Het
Alox15	A	G	11: 70,349,635	M240T	possibly damaging	Het
Antxr2	A	G	5: 97,979,985	V229A	probably damaging	Het
Arap2	G	A	5: 62,683,484	L680F	probably damaging	Het
Btaf1	A	G	19: 36,958,373	T188A	probably benign	Het
Btnl6	G	A	17: 34,515,531	Q86*	probably null	Het
C2cd3	T	A	7: 100,416,062	L685H	probably damaging	Het
Cdh23	T	C	10: 60,413,173	T878A	possibly damaging	Het
Clec4b2	T	C	6: 123,202,149	Y137H	probably damaging	Het
Dchs1	T	A	7: 105,755,836	T2500S	possibly damaging	Het
Def6	A	G	17: 28,217,092	Y75C	probably damaging	Het
Dhx33	A	T	11: 70,993,635	F448L	probably damaging	Het
Dner	C	T	1: 84,494,893		probably benign	Het
Dnmbp	G	A	19: 43,902,231	P366S	probably benign	Het
Eif4g3	T	C	4: 138,175,848	C1160R	possibly damaging	Het
Elmod1	G	A	9: 53,912,901		probably benign	Het
Faah	C	A	4: 116,004,391	L305F	probably damaging	Het
Fam71b	A	G	11: 46,406,804	T312A	unknown	Het
Flt1	A	G	5: 147,571,014		probably benign	Het
Fyco1	A	T	9: 123,822,406	N1196K	probably benign	Het
Galnt18	T	C	7: 111,554,457	N320S	probably damaging	Het
Glp2r	C	A	11: 67,709,712	G437V	possibly damaging	Het
Gm4884	T	C	7: 41,044,292	S562P	probably damaging	Het
Gm9936	A	G	5: 114,857,347		probably benign	Het
Gpn2	C	A	4: 133,584,792	P112T	probably damaging	Het
Grm4	A	G	17: 27,431,575	Y816H	probably benign	Het
Helz2	A	T	2: 181,240,959	S14T	probably benign	Het
Htt	T	C	5: 34,820,104	L778P	probably benign	Het
Il11ra1	T	C	4: 41,765,060	S129P	probably damaging	Het
Ints11	T	C	4: 155,887,168	F315S	probably damaging	Het
Itga11	A	T	9: 62,776,613	N1059Y	possibly damaging	Het
Jak3	A	G	8: 71,684,327	S716G	probably damaging	Het
Kcns1	G	T	2: 164,168,643	D65E	probably benign	Het
Kdm5d	A	T	Y: 941,715	K1305N	probably benign	Het
Kif26a	G	T	12: 112,177,880	V1523L	probably benign	Het
Mboat7	A	G	7: 3,683,822	S340P	probably damaging	Het
Mctp2	T	C	7: 72,229,408	I234V	probably benign	Het
Mex3c	G	A	18: 73,590,551	A572T	probably benign	Het
Mpp3	C	A	11: 102,005,425	R424L	probably benign	Het
Mroh4	T	A	15: 74,608,237		probably benign	Het
Myo9a	A	T	9: 59,860,206		probably benign	Het
Myog	T	A	1: 134,290,235	H60Q	probably damaging	Het
Nlrp9a	T	A	7: 26,571,225		probably null	Het
Olfr352	A	G	2: 36,870,160	N198S	probably damaging	Het
Olfr59	T	A	11: 74,289,051	I135N	possibly damaging	Het
Olfr73	T	C	2: 88,034,266	Y291C	possibly damaging	Het
Olfr980	A	T	9: 40,006,355	I198N	probably damaging	Het
Pink1	T	C	4: 138,317,401	T342A	probably benign	Het
Plb1	T	A	5: 32,349,615		probably benign	Het
Plec	T	C	15: 76,178,246	D2524G	probably damaging	Het
Plekhg4	G	T	8: 105,375,396	E6*	probably null	Het
Polq	T	C	16: 37,061,839	F1455S	possibly damaging	Het
Ppm1e	A	G	11: 87,249,058		probably benign	Het
Prkaca	G	A	8: 83,988,303	M119I	possibly damaging	Het
Prss46	G	T	9: 110,850,055	S108I	probably damaging	Het
Ptma	C	T	1: 86,529,776		probably benign	Het
Rab11fip4	C	T	11: 79,689,653	T437M	probably benign	Het
Rngtt	T	A	4: 33,379,409	M437K	probably benign	Het
Rrn3	T	A	16: 13,813,113	D604E	possibly damaging	Het
Scn4a	A	G	11: 106,348,405		probably benign	Het
Sis	A	G	3: 72,910,476	L1468P	possibly damaging	Het
Slit3	A	G	11: 35,707,918	M1450V	probably benign	Het
Smg5	T	C	3: 88,349,233	S269P	probably benign	Het
Sntg1	T	C	1: 8,463,462	T323A	probably damaging	Het
Son	C	T	16: 91,651,662	T37I	probably damaging	Het
Stk17b	T	C	1: 53,764,132	I41M	probably benign	Het
Tgm5	T	A	2: 121,076,882	Y120F	probably damaging	Het
Tppp	A	G	13: 74,021,360	K73R	possibly damaging	Het
Ttn	C	T	2: 76,907,752	V4148I	probably benign	Het
Ttn	C	A	2: 76,739,158	K27130N	probably damaging	Het
Uba7	A	T	9: 107,978,249	Y375F	probably damaging	Het
Ugcg	T	C	4: 59,213,931	L171P	possibly damaging	Het
Vsig2	T	C	9: 37,542,576		probably benign	Het
Zcchc11	T	A	4: 108,530,955		probably benign	Het
Zfp839	T	A	12: 110,868,386	S692T	possibly damaging	Het

Other mutations in Notch1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00164:Notch1	APN	2	26460046	missense	probably damaging	0.98
IGL01343:Notch1	APN	2	26472905	missense	probably benign	0.25
IGL02066:Notch1	APN	2	26460396	missense	possibly damaging	0.71
IGL02158:Notch1	APN	2	26460339	missense	probably damaging	1.00
IGL02541:Notch1	APN	2	26468503	missense	probably benign	0.12
IGL03280:Notch1	APN	2	26477874	intron	probably benign
IGL03338:Notch1	APN	2	26459959	missense	probably benign
Antero	UTSW	2	26476114	missense	possibly damaging	0.96
march	UTSW	2	26469899	missense	probably damaging	0.98
PIT4494001:Notch1	UTSW	2	26466473	missense	probably damaging	1.00
R0025:Notch1	UTSW	2	26470931	missense	probably damaging	1.00
R0129:Notch1	UTSW	2	26460458	missense	probably benign	0.06
R0285:Notch1	UTSW	2	26460861	missense	possibly damaging	0.88
R0531:Notch1	UTSW	2	26466572	missense	probably benign	0.00
R0747:Notch1	UTSW	2	26472140	missense	unknown
R1440:Notch1	UTSW	2	26480964	intron	probably benign
R1502:Notch1	UTSW	2	26484323	missense	possibly damaging	0.95
R1539:Notch1	UTSW	2	26472113	nonsense	probably null
R1623:Notch1	UTSW	2	26478612	missense	possibly damaging	0.88
R1844:Notch1	UTSW	2	26460434	missense	probably benign	0.12
R1863:Notch1	UTSW	2	26469950	missense	probably damaging	1.00
R1874:Notch1	UTSW	2	26481579	missense	possibly damaging	0.89
R1926:Notch1	UTSW	2	26481657	missense	probably damaging	1.00
R2156:Notch1	UTSW	2	26460861	missense	possibly damaging	0.91
R2196:Notch1	UTSW	2	26463804	nonsense	probably null
R2209:Notch1	UTSW	2	26460007	missense	probably benign
R2382:Notch1	UTSW	2	26473781	missense	probably benign	0.40
R2508:Notch1	UTSW	2	26465473	missense	possibly damaging	0.80
R2873:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R2874:Notch1	UTSW	2	26460235	missense	possibly damaging	0.89
R3798:Notch1	UTSW	2	26478618	missense	probably benign	0.00
R4019:Notch1	UTSW	2	26481142	missense	probably benign	0.03
R4305:Notch1	UTSW	2	26477924	missense	probably damaging	1.00
R4334:Notch1	UTSW	2	26460036	missense	probably benign	0.22
R4504:Notch1	UTSW	2	26472177	missense	probably benign	0.16
R4624:Notch1	UTSW	2	26478081	missense	possibly damaging	0.94
R4659:Notch1	UTSW	2	26470889	missense	probably damaging	0.99
R4703:Notch1	UTSW	2	26471158	missense	probably benign
R4869:Notch1	UTSW	2	26471179	missense	probably benign	0.21
R4938:Notch1	UTSW	2	26474124	nonsense	probably null
R4989:Notch1	UTSW	2	26481181	missense	probably damaging	1.00
R5010:Notch1	UTSW	2	26476114	missense	possibly damaging	0.96
R5283:Notch1	UTSW	2	26468626	missense	probably damaging	1.00
R5303:Notch1	UTSW	2	26478619	missense	probably benign	0.01
R5635:Notch1	UTSW	2	26476161	missense	probably damaging	1.00
R5755:Notch1	UTSW	2	26473692	missense	probably benign	0.12
R5926:Notch1	UTSW	2	26476104	missense	probably benign	0.35
R5947:Notch1	UTSW	2	26462528	intron	probably benign
R6053:Notch1	UTSW	2	26472912	missense	probably benign	0.06
R6161:Notch1	UTSW	2	26468731	missense	probably damaging	1.00
R6162:Notch1	UTSW	2	26462195	missense	probably benign
R6174:Notch1	UTSW	2	26485442	missense	possibly damaging	0.50
R6199:Notch1	UTSW	2	26469899	missense	probably damaging	0.98
R6209:Notch1	UTSW	2	26472805	missense	probably damaging	1.00
R6251:Notch1	UTSW	2	26474170	missense	possibly damaging	0.64
R6493:Notch1	UTSW	2	26472098	missense	unknown
R6723:Notch1	UTSW	2	26478106	missense	probably damaging	1.00
R6736:Notch1	UTSW	2	26460286	missense	probably benign	0.01
R7020:Notch1	UTSW	2	26481574	missense	possibly damaging	0.95
R7058:Notch1	UTSW	2	26463818	missense	probably benign	0.05
R7154:Notch1	UTSW	2	26459938	missense	probably benign
R7291:Notch1	UTSW	2	26476375	missense	probably benign	0.01
R7379:Notch1	UTSW	2	26479467	missense	probably damaging	1.00
R7560:Notch1	UTSW	2	26460165	missense	probably benign	0.43
R7610:Notch1	UTSW	2	26478179	missense	probably benign	0.13
R7833:Notch1	UTSW	2	26459533	makesense	probably null
R7988:Notch1	UTSW	2	26471001	missense	probably benign	0.00
R8493:Notch1	UTSW	2	26472239	missense	unknown
R8514:Notch1	UTSW	2	26472169	missense	probably damaging	1.00
R8523:Notch1	UTSW	2	26464905	missense	possibly damaging	0.82
R8677:Notch1	UTSW	2	26469924	missense	probably damaging	1.00
R8696:Notch1	UTSW	2	26477992	critical splice acceptor site	probably benign
R8833:Notch1	UTSW	2	26481603	missense	probably damaging	1.00
R8964:Notch1	UTSW	2	26481050	missense	possibly damaging	0.65
R9091:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
R9144:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9145:Notch1	UTSW	2	26459575	missense	probably benign	0.00
R9151:Notch1	UTSW	2	26477927	missense	probably benign	0.01
R9270:Notch1	UTSW	2	26479883	missense	probably damaging	0.99
R9463:Notch1	UTSW	2	26469833	missense	probably benign	0.20
R9546:Notch1	UTSW	2	26481115	missense	probably damaging	0.97
R9674:Notch1	UTSW	2	26471296	missense	probably damaging	0.98
X0018:Notch1	UTSW	2	26462227	nonsense	probably null
X0066:Notch1	UTSW	2	26470335	missense	possibly damaging	0.90
Z1088:Notch1	UTSW	2	26477115	missense	probably damaging	0.99
Z1177:Notch1	UTSW	2	26460309	missense	possibly damaging	0.74

Predicted Primers

PCR Primer
(F):5'- ACCAGGGCTATTTTCCACCTCAGAC -3'
(R):5'- AGGAGCCCATCAATGCTGAGCTAC -3'

Sequencing Primer
(F):5'- CCTGTCATGTGTGCTTAGGAAC -3'
(R):5'- tctgggaagctctgggaag -3'

Posted On

2013-05-09