Incidental Mutation 'R4373:Myc'
ID326080
Institutional Source Beutler Lab
Gene Symbol Myc
Ensembl Gene ENSMUSG00000022346
Gene Namemyelocytomatosis oncogene
SynonymsNird, Myc2, Niard, c-myc, bHLHe39
MMRRC Submission 041675-MU
Accession Numbers

VEGA: OTTMUSP00000048877; MGI: 97250

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location61985391-61990374 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 61989664 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 373 (H373L)
Ref Sequence ENSEMBL: ENSMUSP00000130285 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022971] [ENSMUST00000159327] [ENSMUST00000159338] [ENSMUST00000160009] [ENSMUST00000161976] [ENSMUST00000167731] [ENSMUST00000188482] [ENSMUST00000191178]
Predicted Effect possibly damaging
Transcript: ENSMUST00000022971
AA Change: H374L

PolyPhen 2 Score 0.899 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000022971
Gene: ENSMUSG00000022346
AA Change: H374L

DomainStartEndE-ValueType
Pfam:Myc_N 16 360 7e-118 PFAM
HLH 375 427 2.3e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000159327
AA Change: H359L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000124758
Gene: ENSMUSG00000022346
AA Change: H359L

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159338
Predicted Effect possibly damaging
Transcript: ENSMUST00000160009
AA Change: H359L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123852
Gene: ENSMUSG00000022346
AA Change: H359L

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000161976
AA Change: H359L

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000123821
Gene: ENSMUSG00000022346
AA Change: H359L

DomainStartEndE-ValueType
Pfam:Myc_N 1 345 1.4e-141 PFAM
HLH 360 412 2.3e-14 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000167731
AA Change: H373L

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130285
Gene: ENSMUSG00000022346
AA Change: H373L

DomainStartEndE-ValueType
Pfam:Myc_N 15 359 1.5e-141 PFAM
HLH 374 426 2.3e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000188482
AA Change: H374L

PolyPhen 2 Score 0.818 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000140183
Gene: ENSMUSG00000022346
AA Change: H374L

DomainStartEndE-ValueType
Pfam:Myc_N 16 360 1.5e-141 PFAM
HLH 375 427 2.3e-14 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000191178
AA Change: H373L

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141139
Gene: ENSMUSG00000022346
AA Change: H373L

DomainStartEndE-ValueType
Pfam:Myc_N 15 359 1.9e-141 PFAM
HLH 374 426 2.3e-14 SMART
Meta Mutation Damage Score 0.8447 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: The protein encoded by this gene is a multifunctional, nuclear phosphoprotein that plays a role in cell cycle progression, apoptosis and cellular transformation. It functions as a transcription factor that regulates transcription of specific target genes. Mutations, overexpression, rearrangement and translocation of this gene have been associated with a variety of hematopoietic tumors, leukemias and lymphomas, including Burkitt lymphoma, in human. There is evidence to show that alternative translation initiations from an upstream, in-frame non-AUG (CUG) and a downstream AUG start site result in the production of two isoforms with distinct N-termini, in human and mouse. Under conditions of stress, such as high cell densities and methionine deprivation, there is a specific and dramatic increase in the synthesis of the non-AUG initiated protein, suggesting its importance in times of adversity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2010]
PHENOTYPE: Mutations affect growth and development of heart, pericardium, neural tube, vasculogenesis and erythropoeisis. Homozygous null mutants die by embryonic day 10.5. Heterozygotes have reduced body size and multiorgan hypoplasia; females have small litters. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(19) Gene trapped(4)          

Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Dclre1a A G 19: 56,545,442 L240S probably benign Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Myc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Myc APN 15 61989820 missense probably benign 0.03
IGL02372:Myc APN 15 61987858 missense probably damaging 1.00
IGL02400:Myc APN 15 61989911 unclassified probably benign
IGL02677:Myc APN 15 61989664 missense probably damaging 1.00
IGL02834:Myc APN 15 61987666 missense probably damaging 1.00
IGL03330:Myc APN 15 61988149 missense probably benign
PIT1430001:Myc UTSW 15 61987693 missense probably damaging 1.00
R1245:Myc UTSW 15 61987897 missense probably damaging 0.96
R2105:Myc UTSW 15 61988102 missense probably damaging 1.00
R6774:Myc UTSW 15 61988279 critical splice donor site probably null
R6813:Myc UTSW 15 61988152 missense probably damaging 1.00
R7371:Myc UTSW 15 61988182 missense probably damaging 0.97
RF020:Myc UTSW 15 61985823 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- AGGCGTGGCTAACTGTGATC -3'
(R):5'- AAGTCCTTTTCAGAGGTGAGC -3'

Sequencing Primer
(F):5'- TCAAGAGGTGCCACGTCTC -3'
(R):5'- CCTTTTCAGAGGTGAGCTTGTGC -3'
Posted On2015-07-06