Mutagenetix > Incidental Mutations

Incidental Mutation 'R4373:Slc14a2'

326088

Institutional Source

Beutler Lab

Gene Symbol

Slc14a2

Ensembl Gene

ENSMUSG00000024552

Gene Name

solute carrier family 14 (urea transporter), member 2

Synonyms

UT-A5, UT-A3

MMRRC Submission

041675-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4373 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

78146940-78209094 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 78207068 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Cysteine at position 62 (R62C)

Ref Sequence

ENSEMBL: ENSMUSP00000025434 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025434] [ENSMUST00000163367]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000025434
AA Change: R62C

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000025434
Gene: ENSMUSG00000024552
AA Change: R62C

Domain	Start	End	E-Value	Type
low complexity region	11	25	N/A	INTRINSIC
low complexity region	31	43	N/A	INTRINSIC
low complexity region	82	97	N/A	INTRINSIC
Pfam:UT	128	423	1.9e-105	PFAM
low complexity region	460	471	N/A	INTRINSIC
Pfam:UT	591	886	7.5e-112	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000163367

SMART Domains

Protein: ENSMUSP00000126416
Gene: ENSMUSG00000024552

Domain	Start	End	E-Value	Type
Pfam:UT	1	292	3.4e-113	PFAM

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the urea transporter family. In mammalian cells, urea is the chief end product of nitrogen catabolism, and plays an important role in the urinary concentration mechanism. This protein is expressed in the inner medulla of the kidney, and mediates rapid transepithelial urea transport across the inner medullary collecting duct. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Homozygous mice lacking the collecting duct specific isoforms display decreased urea permeability and urine osmolality and increased urine flow. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,265		probably null	Het
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Akr1b3	A	C	6: 34,304,267		probably benign	Het
Asns	A	T	6: 7,677,978	S367T	probably damaging	Het
BC034090	T	C	1: 155,226,158	N120S	probably benign	Het
Bub1	A	T	2: 127,805,236		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Ctsz	T	C	2: 174,428,585	E268G	possibly damaging	Het
Dach1	G	A	14: 97,827,750	T685I	possibly damaging	Het
Dclre1a	A	G	19: 56,545,442	L240S	probably benign	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Esam	C	T	9: 37,534,196	T71I	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Gde1	A	G	7: 118,698,558	L35P	possibly damaging	Het
Gm10382	A	G	5: 125,389,583		probably benign	Het
H2-M10.6	T	C	17: 36,813,066	Y141H	probably damaging	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Lamc3	A	G	2: 31,898,232	K135E	probably damaging	Het
Lrtm2	A	G	6: 119,320,528	F184S	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Mtcl1	T	A	17: 66,380,079	T611S	probably benign	Het
Myc	A	T	15: 61,989,664	H373L	probably damaging	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naaa	T	C	5: 92,278,143		probably benign	Het
Nfib	A	G	4: 82,323,658	V432A	probably damaging	Het
Nmt1	A	G	11: 103,043,200	K55R	probably damaging	Het
Olfr1228	T	C	2: 89,249,245	R150G	possibly damaging	Het
Opa3	C	T	7: 19,244,774	R55W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Pld5	T	A	1: 176,140,017	I91F	probably damaging	Het
Plec	A	C	15: 76,183,117	S1350A	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,765	Y537H	probably damaging	Het
Prdm8	T	C	5: 98,186,508	S645P	probably damaging	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Sgsm1	TTTTATATT	TTT	5: 113,258,123		probably benign	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Stat4	T	C	1: 52,071,941		probably null	Het
Tex9	A	T	9: 72,480,595		probably null	Het
Tsku	T	C	7: 98,352,831	T98A	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r116	A	C	17: 23,401,421	I710L	probably benign	Het
Vmn2r16	A	T	5: 109,363,801	I625F	probably damaging	Het
Xpo4	G	A	14: 57,591,022	Q794*	probably null	Het
Zfp112	T	A	7: 24,125,048	I147N	probably damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Slc14a2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Slc14a2	APN	18	78150438	missense	possibly damaging	0.65
IGL00763:Slc14a2	APN	18	78192238	missense	probably damaging	1.00
IGL01359:Slc14a2	APN	18	78154108	missense	probably benign	0.01
IGL01400:Slc14a2	APN	18	78192213	missense	probably damaging	1.00
IGL01450:Slc14a2	APN	18	78183530	missense	probably damaging	0.97
IGL01469:Slc14a2	APN	18	78155566	missense	probably damaging	0.98
IGL02231:Slc14a2	APN	18	78209021	missense	possibly damaging	0.92
IGL02340:Slc14a2	APN	18	78163126	missense	probably damaging	1.00
IGL02542:Slc14a2	APN	18	78209087	missense	probably benign
xi_ning	UTSW	18	78195747	missense	probably benign	0.01
IGL02991:Slc14a2	UTSW	18	78205834	start codon destroyed	probably null	0.77
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0131:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0132:Slc14a2	UTSW	18	78192123	missense	probably damaging	1.00
R0601:Slc14a2	UTSW	18	78157179	nonsense	probably null
R1677:Slc14a2	UTSW	18	78163204	missense	probably benign
R1749:Slc14a2	UTSW	18	78147080	missense	possibly damaging	0.67
R2014:Slc14a2	UTSW	18	78150386	splice site	probably benign
R2034:Slc14a2	UTSW	18	78183583	missense	probably damaging	0.99
R2264:Slc14a2	UTSW	18	78163089	splice site	probably benign
R2278:Slc14a2	UTSW	18	78159944	missense	probably benign	0.01
R2920:Slc14a2	UTSW	18	78158297	nonsense	probably null
R3878:Slc14a2	UTSW	18	78159074	missense	probably benign
R4086:Slc14a2	UTSW	18	78205783	missense	probably damaging	1.00
R4237:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4238:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4239:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4300:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4375:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4376:Slc14a2	UTSW	18	78207068	missense	probably damaging	1.00
R4440:Slc14a2	UTSW	18	78195747	missense	probably benign	0.01
R4551:Slc14a2	UTSW	18	78195853	missense	probably benign	0.02
R4636:Slc14a2	UTSW	18	78195792	missense	possibly damaging	0.88
R4749:Slc14a2	UTSW	18	78155581	missense	probably damaging	1.00
R4921:Slc14a2	UTSW	18	78192188	missense	probably damaging	0.97
R4983:Slc14a2	UTSW	18	78150401	missense	probably damaging	0.98
R5114:Slc14a2	UTSW	18	78195748	missense	possibly damaging	0.62
R5164:Slc14a2	UTSW	18	78157272	missense	probably damaging	1.00
R5386:Slc14a2	UTSW	18	78185840	missense	possibly damaging	0.65
R5433:Slc14a2	UTSW	18	78208928	missense	probably damaging	1.00
R5558:Slc14a2	UTSW	18	78159166	missense	possibly damaging	0.94
R5571:Slc14a2	UTSW	18	78209067	missense	possibly damaging	0.73
R5693:Slc14a2	UTSW	18	78147014	missense	probably benign	0.23
R5715:Slc14a2	UTSW	18	78158336	missense	probably damaging	1.00
R5719:Slc14a2	UTSW	18	78209042	missense	probably benign	0.06
R6160:Slc14a2	UTSW	18	78158975	critical splice donor site	probably null
R6352:Slc14a2	UTSW	18	78209094	start codon destroyed	probably null
R6380:Slc14a2	UTSW	18	78146975	missense	probably benign	0.00
R6444:Slc14a2	UTSW	18	78154102	missense	probably damaging	0.98
R6480:Slc14a2	UTSW	18	78159082	missense	possibly damaging	0.80
R6732:Slc14a2	UTSW	18	78192174	missense	probably damaging	1.00
R7038:Slc14a2	UTSW	18	78159037	missense	probably damaging	0.98
R7553:Slc14a2	UTSW	18	78155588	missense	probably damaging	1.00
R7558:Slc14a2	UTSW	18	78192119	missense	probably benign	0.07
R7617:Slc14a2	UTSW	18	78159941	missense	probably benign
R7693:Slc14a2	UTSW	18	78154003	missense	possibly damaging	0.81
R7874:Slc14a2	UTSW	18	78160768	missense	probably benign	0.01
R8144:Slc14a2	UTSW	18	78184544	critical splice donor site	probably null
R9205:Slc14a2	UTSW	18	78195736	missense	probably benign	0.19
R9356:Slc14a2	UTSW	18	78184608	missense	probably null	0.02
Z1088:Slc14a2	UTSW	18	78195780	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157368	missense	probably damaging	1.00
Z1176:Slc14a2	UTSW	18	78157369	missense	possibly damaging	0.65

Predicted Primers

PCR Primer
(F):5'- GACACTCACCTTTCAGCCAG -3'
(R):5'- TGTCCCCAAATGTCCCTATCAAG -3'

Sequencing Primer
(F):5'- AGCCAGTTCTTGCATTCCTTCATG -3'
(R):5'- CAAGTACTTATAATCCCAGCAGATG -3'

Posted On

2015-07-06