Mutagenetix > Incidental Mutations

Incidental Mutation 'R4373:Dclre1a'

326089

Institutional Source

Beutler Lab

Gene Symbol

Dclre1a

Ensembl Gene

ENSMUSG00000025077

Gene Name

DNA cross-link repair 1A

Synonyms

2810043H12Rik, SMN1a, SNM1, mSNM1

MMRRC Submission

041675-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R4373 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

56529167-56548222 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 56545442 bp

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 240 (L240S)

Ref Sequence

ENSEMBL: ENSMUSP00000138290 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071423] [ENSMUST00000182059] [ENSMUST00000182276] [ENSMUST00000183143]

Predicted Effect

probably benign
Transcript: ENSMUST00000071423

SMART Domains

Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078

Domain	Start	End	E-Value	Type
Pfam:Thioredoxin_8	78	174	2.7e-14	PFAM
LY	216	258	8.44e0	SMART
Pfam:NHL	278	304	2.3e-9	PFAM
low complexity region	321	331	N/A	INTRINSIC
Blast:LY	402	446	5e-8	BLAST
LY	467	509	1.91e0	SMART
Pfam:NHL	530	558	1.2e-9	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000181992

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000182058

Predicted Effect

probably benign
Transcript: ENSMUST00000182059

Predicted Effect

probably benign
Transcript: ENSMUST00000182276
AA Change: L240S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)

SMART Domains

Protein: ENSMUSP00000138290
Gene: ENSMUSG00000025077
AA Change: L240S

Domain	Start	End	E-Value	Type
low complexity region	90	110	N/A	INTRINSIC
low complexity region	211	220	N/A	INTRINSIC
low complexity region	546	560	N/A	INTRINSIC
Lactamase_B	705	853	7.86e-1	SMART
Pfam:DRMBL	921	1027	1e-38	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000183143

SMART Domains

Protein: ENSMUSP00000138537
Gene: ENSMUSG00000025077

Domain	Start	End	E-Value	Type
low complexity region	90	110	N/A	INTRINSIC

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

98% (54/55)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is involved in the repair of DNA interstrand cross-links. DNA cross-links suppress transcription, replication, and DNA segregation. The encoded protein is a regulator of the mitotic cell cycle checkpoint. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit increased sensitivity to the DNA interstrand cross-linking agent mitomycin C. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,615,265		probably null	Het
3632451O06Rik	T	A	14: 49,770,436	T527S	probably damaging	Het
Adck5	A	G	15: 76,594,335		probably benign	Het
Akr1b3	A	C	6: 34,304,267		probably benign	Het
Asns	A	T	6: 7,677,978	S367T	probably damaging	Het
BC034090	T	C	1: 155,226,158	N120S	probably benign	Het
Bub1	A	T	2: 127,805,236		probably benign	Het
Csf1	T	A	3: 107,756,739	T38S	probably damaging	Het
Ctsz	T	C	2: 174,428,585	E268G	possibly damaging	Het
Dach1	G	A	14: 97,827,750	T685I	possibly damaging	Het
Ercc1	G	A	7: 19,347,132		probably benign	Het
Esam	C	T	9: 37,534,196	T71I	probably benign	Het
Espl1	A	G	15: 102,312,989	I944V	probably damaging	Het
Gde1	A	G	7: 118,698,558	L35P	possibly damaging	Het
Gm10382	A	G	5: 125,389,583		probably benign	Het
H2-M10.6	T	C	17: 36,813,066	Y141H	probably damaging	Het
Hk1	C	A	10: 62,315,540	K10N	probably damaging	Het
Lamc3	A	G	2: 31,898,232	K135E	probably damaging	Het
Lrtm2	A	G	6: 119,320,528	F184S	probably damaging	Het
March11	A	G	15: 26,309,446	E62G	probably damaging	Het
Mtcl1	T	A	17: 66,380,079	T611S	probably benign	Het
Myc	A	T	15: 61,989,664	H373L	probably damaging	Het
Myh6	T	A	14: 54,962,108	I249F	probably damaging	Het
Naaa	T	C	5: 92,278,143		probably benign	Het
Nfib	A	G	4: 82,323,658	V432A	probably damaging	Het
Nmt1	A	G	11: 103,043,200	K55R	probably damaging	Het
Olfr1228	T	C	2: 89,249,245	R150G	possibly damaging	Het
Opa3	C	T	7: 19,244,774	R55W	probably damaging	Het
Pfn4	T	A	12: 4,770,182	D10E	probably damaging	Het
Pld5	T	A	1: 176,140,017	I91F	probably damaging	Het
Plec	A	C	15: 76,183,117	S1350A	probably damaging	Het
Polq	G	T	16: 37,013,181	V79F	probably damaging	Het
Ppp1r16b	T	C	2: 158,761,765	Y537H	probably damaging	Het
Prdm8	T	C	5: 98,186,508	S645P	probably damaging	Het
Rgs1	T	C	1: 144,247,906	T94A	probably benign	Het
Rpl11	G	A	4: 136,051,143		probably benign	Het
Scamp3	G	A	3: 89,181,927		probably null	Het
Sgsm1	TTTTATATT	TTT	5: 113,258,123		probably benign	Het
Sirpb1b	A	T	3: 15,548,761	I87K	probably damaging	Het
Slc14a2	G	A	18: 78,207,068	R62C	probably damaging	Het
Stat4	T	C	1: 52,071,941		probably null	Het
Tex9	A	T	9: 72,480,595		probably null	Het
Tsku	T	C	7: 98,352,831	T98A	probably benign	Het
Ttc23l	CT	CTTGGATT	15: 10,537,562		probably benign	Het
Ttc23l	G	A	15: 10,537,566	S206L	probably benign	Het
Vmn2r116	A	C	17: 23,401,421	I710L	probably benign	Het
Vmn2r16	A	T	5: 109,363,801	I625F	probably damaging	Het
Xpo4	G	A	14: 57,591,022	Q794*	probably null	Het
Zfp112	T	A	7: 24,125,048	I147N	probably damaging	Het
Zmiz1	T	C	14: 25,636,010	S140P	probably damaging	Het

Other mutations in Dclre1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01655:Dclre1a	APN	19	56547057	missense	probably damaging	1.00
IGL02113:Dclre1a	APN	19	56541532	missense	probably damaging	0.98
IGL02264:Dclre1a	APN	19	56544293	missense	possibly damaging	0.93
IGL03303:Dclre1a	APN	19	56546766	missense	possibly damaging	0.85
Gof	UTSW	19	56542709	missense	probably damaging	1.00
Hoopla	UTSW	19	56546635	critical splice donor site	probably null
FR4589:Dclre1a	UTSW	19	56544123	utr 3 prime	probably benign
PIT4377001:Dclre1a	UTSW	19	56544405	missense	probably benign	0.05
R0081:Dclre1a	UTSW	19	56542707	missense	probably damaging	1.00
R0355:Dclre1a	UTSW	19	56546635	critical splice donor site	probably null
R0422:Dclre1a	UTSW	19	56544135	nonsense	probably null
R0486:Dclre1a	UTSW	19	56541490	splice site	probably benign
R0619:Dclre1a	UTSW	19	56545409	missense	probably benign	0.00
R0639:Dclre1a	UTSW	19	56538440	missense	probably damaging	1.00
R1221:Dclre1a	UTSW	19	56531268	missense	possibly damaging	0.69
R1352:Dclre1a	UTSW	19	56545163	missense	probably damaging	1.00
R1824:Dclre1a	UTSW	19	56546718	unclassified	probably null
R1833:Dclre1a	UTSW	19	56541500	splice site	probably null
R3851:Dclre1a	UTSW	19	56541507	missense	probably damaging	1.00
R3889:Dclre1a	UTSW	19	56545320	missense	probably benign	0.00
R5277:Dclre1a	UTSW	19	56544732	missense	possibly damaging	0.78
R5747:Dclre1a	UTSW	19	56541532	missense	probably damaging	0.98
R5792:Dclre1a	UTSW	19	56529590	missense	probably damaging	1.00
R5892:Dclre1a	UTSW	19	56547140	missense	probably benign	0.29
R5993:Dclre1a	UTSW	19	56542737	missense	probably damaging	1.00
R6368:Dclre1a	UTSW	19	56546791	missense	probably benign	0.02
R6706:Dclre1a	UTSW	19	56545069	missense	probably benign	0.11
R6944:Dclre1a	UTSW	19	56545019	missense	possibly damaging	0.90
R6960:Dclre1a	UTSW	19	56542709	missense	probably damaging	1.00
R7023:Dclre1a	UTSW	19	56540206	missense	probably damaging	0.99
R7213:Dclre1a	UTSW	19	56529635	missense	probably damaging	1.00
R7355:Dclre1a	UTSW	19	56547135	missense	possibly damaging	0.53
R7413:Dclre1a	UTSW	19	56542650	missense	probably damaging	1.00
R7577:Dclre1a	UTSW	19	56529533	missense	probably damaging	1.00
RF031:Dclre1a	UTSW	19	56544132	utr 3 prime	probably benign
RF046:Dclre1a	UTSW	19	56544132	utr 3 prime	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGCTGTTTAATGCAACCTCAG -3'
(R):5'- AATGTCCCGAGGGTTTGCTATG -3'

Sequencing Primer
(F):5'- CTGTTTAATGCAACCTCAGCAAGAG -3'
(R):5'- CGAGGGTTTGCTATGTACTTCCAC -3'

Posted On

2015-07-06