Incidental Mutation 'R4373:Dclre1a'
ID326089
Institutional Source Beutler Lab
Gene Symbol Dclre1a
Ensembl Gene ENSMUSG00000025077
Gene NameDNA cross-link repair 1A
Synonyms2810043H12Rik, SMN1a, SNM1, mSNM1
MMRRC Submission 041675-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4373 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location56529167-56548222 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 56545442 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 240 (L240S)
Ref Sequence ENSEMBL: ENSMUSP00000138290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071423] [ENSMUST00000182059] [ENSMUST00000182276] [ENSMUST00000183143]
Predicted Effect probably benign
Transcript: ENSMUST00000071423
SMART Domains Protein: ENSMUSP00000071370
Gene: ENSMUSG00000025078

DomainStartEndE-ValueType
Pfam:Thioredoxin_8 78 174 2.7e-14 PFAM
LY 216 258 8.44e0 SMART
Pfam:NHL 278 304 2.3e-9 PFAM
low complexity region 321 331 N/A INTRINSIC
Blast:LY 402 446 5e-8 BLAST
LY 467 509 1.91e0 SMART
Pfam:NHL 530 558 1.2e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000181992
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182058
Predicted Effect probably benign
Transcript: ENSMUST00000182059
Predicted Effect probably benign
Transcript: ENSMUST00000182276
AA Change: L240S

PolyPhen 2 Score 0.040 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000138290
Gene: ENSMUSG00000025077
AA Change: L240S

DomainStartEndE-ValueType
low complexity region 90 110 N/A INTRINSIC
low complexity region 211 220 N/A INTRINSIC
low complexity region 546 560 N/A INTRINSIC
Lactamase_B 705 853 7.86e-1 SMART
Pfam:DRMBL 921 1027 1e-38 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183143
SMART Domains Protein: ENSMUSP00000138537
Gene: ENSMUSG00000025077

DomainStartEndE-ValueType
low complexity region 90 110 N/A INTRINSIC
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.9%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conserved protein that is involved in the repair of DNA interstrand cross-links. DNA cross-links suppress transcription, replication, and DNA segregation. The encoded protein is a regulator of the mitotic cell cycle checkpoint. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2012]
PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile but exhibit increased sensitivity to the DNA interstrand cross-linking agent mitomycin C. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,615,265 probably null Het
3632451O06Rik T A 14: 49,770,436 T527S probably damaging Het
Adck5 A G 15: 76,594,335 probably benign Het
Akr1b3 A C 6: 34,304,267 probably benign Het
Asns A T 6: 7,677,978 S367T probably damaging Het
BC034090 T C 1: 155,226,158 N120S probably benign Het
Bub1 A T 2: 127,805,236 probably benign Het
Csf1 T A 3: 107,756,739 T38S probably damaging Het
Ctsz T C 2: 174,428,585 E268G possibly damaging Het
Dach1 G A 14: 97,827,750 T685I possibly damaging Het
Ercc1 G A 7: 19,347,132 probably benign Het
Esam C T 9: 37,534,196 T71I probably benign Het
Espl1 A G 15: 102,312,989 I944V probably damaging Het
Gde1 A G 7: 118,698,558 L35P possibly damaging Het
Gm10382 A G 5: 125,389,583 probably benign Het
H2-M10.6 T C 17: 36,813,066 Y141H probably damaging Het
Hk1 C A 10: 62,315,540 K10N probably damaging Het
Lamc3 A G 2: 31,898,232 K135E probably damaging Het
Lrtm2 A G 6: 119,320,528 F184S probably damaging Het
March11 A G 15: 26,309,446 E62G probably damaging Het
Mtcl1 T A 17: 66,380,079 T611S probably benign Het
Myc A T 15: 61,989,664 H373L probably damaging Het
Myh6 T A 14: 54,962,108 I249F probably damaging Het
Naaa T C 5: 92,278,143 probably benign Het
Nfib A G 4: 82,323,658 V432A probably damaging Het
Nmt1 A G 11: 103,043,200 K55R probably damaging Het
Olfr1228 T C 2: 89,249,245 R150G possibly damaging Het
Opa3 C T 7: 19,244,774 R55W probably damaging Het
Pfn4 T A 12: 4,770,182 D10E probably damaging Het
Pld5 T A 1: 176,140,017 I91F probably damaging Het
Plec A C 15: 76,183,117 S1350A probably damaging Het
Polq G T 16: 37,013,181 V79F probably damaging Het
Ppp1r16b T C 2: 158,761,765 Y537H probably damaging Het
Prdm8 T C 5: 98,186,508 S645P probably damaging Het
Rgs1 T C 1: 144,247,906 T94A probably benign Het
Rpl11 G A 4: 136,051,143 probably benign Het
Scamp3 G A 3: 89,181,927 probably null Het
Sgsm1 TTTTATATT TTT 5: 113,258,123 probably benign Het
Sirpb1b A T 3: 15,548,761 I87K probably damaging Het
Slc14a2 G A 18: 78,207,068 R62C probably damaging Het
Stat4 T C 1: 52,071,941 probably null Het
Tex9 A T 9: 72,480,595 probably null Het
Tsku T C 7: 98,352,831 T98A probably benign Het
Ttc23l CT CTTGGATT 15: 10,537,562 probably benign Het
Ttc23l G A 15: 10,537,566 S206L probably benign Het
Vmn2r116 A C 17: 23,401,421 I710L probably benign Het
Vmn2r16 A T 5: 109,363,801 I625F probably damaging Het
Xpo4 G A 14: 57,591,022 Q794* probably null Het
Zfp112 T A 7: 24,125,048 I147N probably damaging Het
Zmiz1 T C 14: 25,636,010 S140P probably damaging Het
Other mutations in Dclre1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01655:Dclre1a APN 19 56547057 missense probably damaging 1.00
IGL02113:Dclre1a APN 19 56541532 missense probably damaging 0.98
IGL02264:Dclre1a APN 19 56544293 missense possibly damaging 0.93
IGL03303:Dclre1a APN 19 56546766 missense possibly damaging 0.85
Gof UTSW 19 56542709 missense probably damaging 1.00
Hoopla UTSW 19 56546635 critical splice donor site probably null
FR4589:Dclre1a UTSW 19 56544123 utr 3 prime probably benign
PIT4377001:Dclre1a UTSW 19 56544405 missense probably benign 0.05
R0081:Dclre1a UTSW 19 56542707 missense probably damaging 1.00
R0355:Dclre1a UTSW 19 56546635 critical splice donor site probably null
R0422:Dclre1a UTSW 19 56544135 nonsense probably null
R0486:Dclre1a UTSW 19 56541490 splice site probably benign
R0619:Dclre1a UTSW 19 56545409 missense probably benign 0.00
R0639:Dclre1a UTSW 19 56538440 missense probably damaging 1.00
R1221:Dclre1a UTSW 19 56531268 missense possibly damaging 0.69
R1352:Dclre1a UTSW 19 56545163 missense probably damaging 1.00
R1824:Dclre1a UTSW 19 56546718 unclassified probably null
R1833:Dclre1a UTSW 19 56541500 splice site probably null
R3851:Dclre1a UTSW 19 56541507 missense probably damaging 1.00
R3889:Dclre1a UTSW 19 56545320 missense probably benign 0.00
R5277:Dclre1a UTSW 19 56544732 missense possibly damaging 0.78
R5747:Dclre1a UTSW 19 56541532 missense probably damaging 0.98
R5792:Dclre1a UTSW 19 56529590 missense probably damaging 1.00
R5892:Dclre1a UTSW 19 56547140 missense probably benign 0.29
R5993:Dclre1a UTSW 19 56542737 missense probably damaging 1.00
R6368:Dclre1a UTSW 19 56546791 missense probably benign 0.02
R6706:Dclre1a UTSW 19 56545069 missense probably benign 0.11
R6944:Dclre1a UTSW 19 56545019 missense possibly damaging 0.90
R6960:Dclre1a UTSW 19 56542709 missense probably damaging 1.00
R7023:Dclre1a UTSW 19 56540206 missense probably damaging 0.99
R7213:Dclre1a UTSW 19 56529635 missense probably damaging 1.00
R7355:Dclre1a UTSW 19 56547135 missense possibly damaging 0.53
R7413:Dclre1a UTSW 19 56542650 missense probably damaging 1.00
R7577:Dclre1a UTSW 19 56529533 missense probably damaging 1.00
RF031:Dclre1a UTSW 19 56544132 utr 3 prime probably benign
RF046:Dclre1a UTSW 19 56544132 utr 3 prime probably benign
Predicted Primers PCR Primer
(F):5'- TGGCTGTTTAATGCAACCTCAG -3'
(R):5'- AATGTCCCGAGGGTTTGCTATG -3'

Sequencing Primer
(F):5'- CTGTTTAATGCAACCTCAGCAAGAG -3'
(R):5'- CGAGGGTTTGCTATGTACTTCCAC -3'
Posted On2015-07-06