Incidental Mutation 'R4384:Frmd4a'
ID326093
Institutional Source Beutler Lab
Gene Symbol Frmd4a
Ensembl Gene ENSMUSG00000026657
Gene NameFERM domain containing 4A
SynonymsGm13190, 2700017I06Rik, C230040M21Rik
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.203) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location4017717-4614043 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 4594563 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 467 (R467*)
Ref Sequence ENSEMBL: ENSMUSP00000134788 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075767] [ENSMUST00000091497] [ENSMUST00000175944] [ENSMUST00000176828] [ENSMUST00000176864] [ENSMUST00000177457]
Predicted Effect probably null
Transcript: ENSMUST00000075767
AA Change: R452*
SMART Domains Protein: ENSMUSP00000075172
Gene: ENSMUSG00000026657
AA Change: R452*

DomainStartEndE-ValueType
B41 1 206 3.24e-40 SMART
FERM_C 210 311 7.69e-27 SMART
Pfam:DUF3338 340 477 1.9e-63 PFAM
low complexity region 558 571 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 732 741 N/A INTRINSIC
low complexity region 764 785 N/A INTRINSIC
low complexity region 790 801 N/A INTRINSIC
low complexity region 924 947 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000091497
AA Change: R463*
SMART Domains Protein: ENSMUSP00000089079
Gene: ENSMUSG00000026657
AA Change: R463*

DomainStartEndE-ValueType
B41 12 217 3.24e-40 SMART
FERM_C 221 322 7.69e-27 SMART
Pfam:DUF3338 352 487 6.3e-61 PFAM
low complexity region 569 582 N/A INTRINSIC
low complexity region 621 634 N/A INTRINSIC
low complexity region 743 752 N/A INTRINSIC
low complexity region 775 796 N/A INTRINSIC
low complexity region 801 812 N/A INTRINSIC
low complexity region 935 958 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153160
Predicted Effect probably null
Transcript: ENSMUST00000175944
AA Change: R500*
SMART Domains Protein: ENSMUSP00000135686
Gene: ENSMUSG00000026657
AA Change: R500*

DomainStartEndE-ValueType
B41 49 254 3.24e-40 SMART
FERM_C 258 359 7.69e-27 SMART
Pfam:DUF3338 388 525 6.5e-64 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000176828
AA Change: R158*
SMART Domains Protein: ENSMUSP00000134803
Gene: ENSMUSG00000026657
AA Change: R158*

DomainStartEndE-ValueType
Pfam:DUF3338 46 183 4.1e-64 PFAM
low complexity region 264 277 N/A INTRINSIC
low complexity region 316 329 N/A INTRINSIC
low complexity region 438 447 N/A INTRINSIC
low complexity region 470 491 N/A INTRINSIC
low complexity region 496 507 N/A INTRINSIC
low complexity region 630 653 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176864
SMART Domains Protein: ENSMUSP00000135057
Gene: ENSMUSG00000026657

DomainStartEndE-ValueType
Pfam:DUF3338 35 150 2.6e-50 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000177457
AA Change: R467*
SMART Domains Protein: ENSMUSP00000134788
Gene: ENSMUSG00000026657
AA Change: R467*

DomainStartEndE-ValueType
B41 16 221 3.24e-40 SMART
FERM_C 225 326 7.69e-27 SMART
Pfam:DUF3338 355 492 3.9e-63 PFAM
low complexity region 573 586 N/A INTRINSIC
low complexity region 625 638 N/A INTRINSIC
low complexity region 747 756 N/A INTRINSIC
low complexity region 779 800 N/A INTRINSIC
low complexity region 805 816 N/A INTRINSIC
low complexity region 939 962 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a FERM domain-containing protein that regulates epithelial cell polarity. It connects ADP ribosylation factor 6 (ARF6) with the Par protein complex, which regulates the remodeling of adherens junctions and linear actin cable formation during epithelial cell polarization. Polymorphisms in this gene are associated with Alzheimer's disease, and also with nicotine dependence. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Frmd4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Frmd4a APN 2 4594714 missense probably benign 0.00
IGL00508:Frmd4a APN 2 4594734 nonsense probably null
IGL01331:Frmd4a APN 2 4602225 missense probably benign 0.32
IGL01774:Frmd4a APN 2 4535236 splice site probably benign
IGL01909:Frmd4a APN 2 4604033 missense probably benign 0.11
IGL02170:Frmd4a APN 2 4566177 missense probably damaging 0.99
IGL02269:Frmd4a APN 2 4604234 missense probably benign 0.19
IGL02377:Frmd4a APN 2 4534574 missense possibly damaging 0.47
IGL03308:Frmd4a APN 2 4498026 missense possibly damaging 0.95
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0066:Frmd4a UTSW 2 4473152 missense probably damaging 1.00
R0081:Frmd4a UTSW 2 4572441 critical splice donor site probably null
R0128:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0130:Frmd4a UTSW 2 4604092 missense probably damaging 0.98
R0376:Frmd4a UTSW 2 4572387 missense probably damaging 0.97
R0529:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R0549:Frmd4a UTSW 2 4603967 missense possibly damaging 0.76
R1593:Frmd4a UTSW 2 4473188 missense probably damaging 1.00
R1959:Frmd4a UTSW 2 4535186 missense probably damaging 1.00
R2002:Frmd4a UTSW 2 4572365 missense probably damaging 1.00
R2100:Frmd4a UTSW 2 4606023 missense probably damaging 1.00
R2310:Frmd4a UTSW 2 4572399 frame shift probably null
R2340:Frmd4a UTSW 2 4586376 missense probably damaging 1.00
R2426:Frmd4a UTSW 2 4529862 missense probably damaging 1.00
R2680:Frmd4a UTSW 2 4534553 missense probably damaging 1.00
R3409:Frmd4a UTSW 2 4153028 intron probably benign
R3772:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3773:Frmd4a UTSW 2 4590622 missense probably damaging 0.99
R3932:Frmd4a UTSW 2 4537260 missense probably damaging 1.00
R4094:Frmd4a UTSW 2 4611032 missense probably damaging 1.00
R4226:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4299:Frmd4a UTSW 2 4333071 missense probably benign 0.02
R4304:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4306:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4307:Frmd4a UTSW 2 4333078 missense probably benign 0.00
R4346:Frmd4a UTSW 2 4608033 missense possibly damaging 0.92
R4360:Frmd4a UTSW 2 4601241 missense probably damaging 1.00
R4547:Frmd4a UTSW 2 4473145 missense probably damaging 1.00
R4575:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4577:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4578:Frmd4a UTSW 2 4603679 missense possibly damaging 0.83
R4688:Frmd4a UTSW 2 4537311 missense possibly damaging 0.81
R4764:Frmd4a UTSW 2 4603448 missense probably damaging 1.00
R4826:Frmd4a UTSW 2 4601297 missense probably damaging 1.00
R4879:Frmd4a UTSW 2 4529817 missense probably damaging 1.00
R5053:Frmd4a UTSW 2 4603921 missense probably damaging 1.00
R5392:Frmd4a UTSW 2 4594573 missense probably damaging 1.00
R5733:Frmd4a UTSW 2 4300957 missense possibly damaging 0.53
R5762:Frmd4a UTSW 2 4484065 missense probably damaging 1.00
R5920:Frmd4a UTSW 2 4333116 missense probably benign 0.02
R5932:Frmd4a UTSW 2 4529839 missense probably damaging 1.00
R6117:Frmd4a UTSW 2 4602249 missense possibly damaging 0.66
R6328:Frmd4a UTSW 2 4590698 missense probably damaging 0.99
R6622:Frmd4a UTSW 2 4606062 missense probably benign 0.00
R6903:Frmd4a UTSW 2 4586456 missense probably damaging 1.00
R7065:Frmd4a UTSW 2 4566112
R7098:Frmd4a UTSW 2 4572433 missense probably damaging 1.00
R7258:Frmd4a UTSW 2 4300953 missense probably benign
R7336:Frmd4a UTSW 2 4473214 missense possibly damaging 0.92
R7582:Frmd4a UTSW 2 4594597 frame shift probably null
R7583:Frmd4a UTSW 2 4594597 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TACTAGCAACGGTTCTGACTTTC -3'
(R):5'- TCGATGACAAGTGAAGCCCTC -3'

Sequencing Primer
(F):5'- AGCAACGGTTCTGACTTTCCTCTAAG -3'
(R):5'- ACAAGTGAAGCCCTCTGGGTG -3'
Posted On2015-07-06