Incidental Mutation 'R4384:Olfr341'
ID326096
Institutional Source Beutler Lab
Gene Symbol Olfr341
Ensembl Gene ENSMUSG00000075387
Gene Nameolfactory receptor 341
SynonymsGA_x6K02T2NLDC-33174915-33173974, MOR136-2
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location36473721-36482468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 36479998 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 44 (L44P)
Ref Sequence ENSEMBL: ENSMUSP00000150801 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100154] [ENSMUST00000213300]
Predicted Effect probably damaging
Transcript: ENSMUST00000100154
AA Change: L44P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000097731
Gene: ENSMUSG00000075387
AA Change: L44P

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.6e-59 PFAM
Pfam:7TM_GPCR_Srsx 35 305 4e-6 PFAM
Pfam:7tm_1 41 290 9.1e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213300
AA Change: L44P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.7192 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Olfr341
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01455:Olfr341 APN 2 36479356 missense probably damaging 1.00
IGL01469:Olfr341 APN 2 36479824 missense probably benign 0.44
IGL02269:Olfr341 APN 2 36479567 missense possibly damaging 0.86
IGL02870:Olfr341 APN 2 36480031 missense probably benign
IGL03190:Olfr341 APN 2 36479722 missense probably damaging 1.00
R0988:Olfr341 UTSW 2 36479767 missense probably damaging 1.00
R1214:Olfr341 UTSW 2 36479969 missense possibly damaging 0.67
R1785:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R1786:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2130:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2131:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2132:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2133:Olfr341 UTSW 2 36480047 missense possibly damaging 0.87
R2568:Olfr341 UTSW 2 36479974 missense probably damaging 1.00
R4115:Olfr341 UTSW 2 36479785 missense probably damaging 1.00
R4721:Olfr341 UTSW 2 36479824 missense probably benign 0.44
R5375:Olfr341 UTSW 2 36479297 missense probably damaging 0.98
R6035:Olfr341 UTSW 2 36479984 missense probably damaging 1.00
R6035:Olfr341 UTSW 2 36479984 missense probably damaging 1.00
R6084:Olfr341 UTSW 2 36479512 missense probably benign 0.01
R6340:Olfr341 UTSW 2 36480020 missense probably benign 0.31
R7238:Olfr341 UTSW 2 36479714 missense possibly damaging 0.54
R7532:Olfr341 UTSW 2 36480126 start codon destroyed probably null 0.27
R7830:Olfr341 UTSW 2 36479380 missense probably damaging 1.00
R7910:Olfr341 UTSW 2 36479333 missense probably damaging 0.98
R7991:Olfr341 UTSW 2 36479333 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- TGTCATAGGCCATGGAGGTC -3'
(R):5'- GGCACCTTGATCTGGAAATGG -3'

Sequencing Primer
(F):5'- CCATGGAGGTCAGAAGAAAACTGTC -3'
(R):5'- ATCACAGCTCATTTTTGTCACAG -3'
Posted On2015-07-06