Incidental Mutation 'R4384:Rwdd3'
ID326099
Institutional Source Beutler Lab
Gene Symbol Rwdd3
Ensembl Gene ENSMUSG00000028133
Gene NameRWD domain containing 3
Synonyms
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location121155398-121171695 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 121158757 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039761] [ENSMUST00000106466] [ENSMUST00000106467] [ENSMUST00000164925] [ENSMUST00000170781]
Predicted Effect probably benign
Transcript: ENSMUST00000039761
SMART Domains Protein: ENSMUSP00000040826
Gene: ENSMUSG00000028133

DomainStartEndE-ValueType
RWD 7 114 3.63e-10 SMART
Pfam:DUF1115 144 262 1.7e-9 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106465
Predicted Effect probably benign
Transcript: ENSMUST00000106466
SMART Domains Protein: ENSMUSP00000102074
Gene: ENSMUSG00000028133

DomainStartEndE-ValueType
RWD 7 114 3.63e-10 SMART
Pfam:DUF1115 144 262 1.7e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106467
SMART Domains Protein: ENSMUSP00000102075
Gene: ENSMUSG00000028133

DomainStartEndE-ValueType
RWD 7 186 1.52e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000164573
SMART Domains Protein: ENSMUSP00000130734
Gene: ENSMUSG00000028133

DomainStartEndE-ValueType
Blast:RWD 2 36 1e-13 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000164925
SMART Domains Protein: ENSMUSP00000133036
Gene: ENSMUSG00000028133

DomainStartEndE-ValueType
PDB:2EBK|A 1 23 2e-6 PDB
Blast:RWD 26 111 6e-42 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000164968
Predicted Effect probably benign
Transcript: ENSMUST00000170781
SMART Domains Protein: ENSMUSP00000129262
Gene: ENSMUSG00000028133

DomainStartEndE-ValueType
RWD 7 114 3.63e-10 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Rwdd3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01317:Rwdd3 APN 3 121171633 missense possibly damaging 0.79
IGL02367:Rwdd3 APN 3 121159030 missense probably damaging 0.99
R0466:Rwdd3 UTSW 3 121159019 missense possibly damaging 0.82
R0733:Rwdd3 UTSW 3 121171607 missense probably benign
R4270:Rwdd3 UTSW 3 121158901 missense probably damaging 1.00
R4650:Rwdd3 UTSW 3 121159177 missense probably damaging 1.00
R4960:Rwdd3 UTSW 3 121158821 missense probably damaging 1.00
R5061:Rwdd3 UTSW 3 121159783 intron probably benign
R6000:Rwdd3 UTSW 3 121156513 missense probably damaging 1.00
R6480:Rwdd3 UTSW 3 121156452 missense probably damaging 1.00
R7117:Rwdd3 UTSW 3 121171338 missense probably benign 0.21
R7471:Rwdd3 UTSW 3 121171312 missense probably benign 0.10
R7615:Rwdd3 UTSW 3 121171604 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATGCTAATCCTGAACCTTGCAAG -3'
(R):5'- CCGTGGATGACTCTTTTGCG -3'

Sequencing Primer
(F):5'- GTGAGCATCAGAGGCTTTTCTAAACG -3'
(R):5'- TGCGTTTAGATCACATGAGAGC -3'
Posted On2015-07-06