Incidental Mutation 'R4384:Nwd2'
ID326102
Institutional Source Beutler Lab
Gene Symbol Nwd2
Ensembl Gene ENSMUSG00000090061
Gene NameNACHT and WD repeat domain containing 2
Synonyms3110047P20Rik, B830017A01Rik
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location63649102-63810546 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 63806571 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 1166 (L1166H)
Ref Sequence ENSEMBL: ENSMUSP00000124712 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000159584]
Predicted Effect probably damaging
Transcript: ENSMUST00000159584
AA Change: L1166H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000124712
Gene: ENSMUSG00000090061
AA Change: L1166H

DomainStartEndE-ValueType
Pfam:DUF4062 42 145 1.5e-8 PFAM
Blast:AAA 408 691 3e-29 BLAST
WD40 939 995 1.06e2 SMART
WD40 998 1037 8.96e-2 SMART
Blast:WD40 1091 1126 9e-19 BLAST
Blast:WD40 1129 1170 1e-17 BLAST
Blast:WD40 1220 1260 3e-16 BLAST
WD40 1263 1302 3.4e-2 SMART
WD40 1347 1385 2.65e1 SMART
WD40 1386 1425 1.58e2 SMART
Blast:WD40 1466 1507 3e-19 BLAST
Blast:WD40 1606 1644 4e-18 BLAST
Blast:KR 1686 1730 2e-16 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000162757
Meta Mutation Damage Score 0.5070 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Nwd2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Nwd2 APN 5 63805475 missense probably benign
IGL01111:Nwd2 APN 5 63807300 missense probably damaging 1.00
IGL01152:Nwd2 APN 5 63806529 missense possibly damaging 0.74
IGL01307:Nwd2 APN 5 63808283 missense possibly damaging 0.95
IGL01449:Nwd2 APN 5 63805594 missense probably damaging 1.00
IGL01624:Nwd2 APN 5 63806810 missense probably damaging 1.00
IGL01997:Nwd2 APN 5 63804595 missense probably damaging 0.99
IGL02007:Nwd2 APN 5 63804699 missense possibly damaging 0.87
IGL02143:Nwd2 APN 5 63791653 splice site probably null
IGL02184:Nwd2 APN 5 63805677 missense probably damaging 1.00
IGL02379:Nwd2 APN 5 63805301 missense probably damaging 1.00
IGL02489:Nwd2 APN 5 63805227 missense probably damaging 1.00
IGL02580:Nwd2 APN 5 63808169 missense probably damaging 0.99
IGL02682:Nwd2 APN 5 63804677 missense probably benign 0.03
IGL02682:Nwd2 APN 5 63804678 missense probably damaging 1.00
IGL02891:Nwd2 APN 5 63725227 missense possibly damaging 0.91
IGL03135:Nwd2 APN 5 63805995 missense probably damaging 1.00
IGL03149:Nwd2 APN 5 63805995 missense probably damaging 1.00
R0113:Nwd2 UTSW 5 63807898 missense probably damaging 1.00
R0172:Nwd2 UTSW 5 63806369 missense probably benign 0.44
R0196:Nwd2 UTSW 5 63806351 missense probably benign 0.37
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0239:Nwd2 UTSW 5 63800124 missense probably benign 0.01
R0309:Nwd2 UTSW 5 63807218 missense probably damaging 1.00
R0311:Nwd2 UTSW 5 63804998 missense probably damaging 0.99
R0335:Nwd2 UTSW 5 63804773 missense probably benign 0.00
R0384:Nwd2 UTSW 5 63805682 missense probably benign 0.11
R0496:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0497:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0498:Nwd2 UTSW 5 63806343 missense probably damaging 0.99
R0505:Nwd2 UTSW 5 63805111 missense probably damaging 1.00
R0655:Nwd2 UTSW 5 63791585 missense possibly damaging 0.73
R0762:Nwd2 UTSW 5 63800414 missense probably benign 0.33
R0835:Nwd2 UTSW 5 63800130 missense probably damaging 0.99
R0926:Nwd2 UTSW 5 63807891 missense probably damaging 0.99
R0948:Nwd2 UTSW 5 63807312 missense probably damaging 1.00
R1015:Nwd2 UTSW 5 63806811 missense probably damaging 1.00
R1086:Nwd2 UTSW 5 63806574 missense probably damaging 1.00
R1186:Nwd2 UTSW 5 63650024 utr 5 prime probably benign
R1305:Nwd2 UTSW 5 63745197 missense probably damaging 0.97
R1542:Nwd2 UTSW 5 63806975 missense probably damaging 1.00
R1548:Nwd2 UTSW 5 63800182 missense probably benign 0.00
R1553:Nwd2 UTSW 5 63800505 missense probably benign 0.00
R1636:Nwd2 UTSW 5 63807557 missense probably damaging 1.00
R1658:Nwd2 UTSW 5 63807246 missense probably damaging 1.00
R1763:Nwd2 UTSW 5 63808271 missense probably benign
R1800:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R1813:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1861:Nwd2 UTSW 5 63804854 missense probably damaging 0.96
R1889:Nwd2 UTSW 5 63807666 missense possibly damaging 0.49
R1896:Nwd2 UTSW 5 63805410 missense probably benign 0.00
R1919:Nwd2 UTSW 5 63806180 missense probably damaging 1.00
R1922:Nwd2 UTSW 5 63794242 missense probably benign
R2258:Nwd2 UTSW 5 63805156 missense probably benign 0.00
R2292:Nwd2 UTSW 5 63805574 missense probably benign 0.15
R2504:Nwd2 UTSW 5 63804374 missense probably benign 0.02
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2869:Nwd2 UTSW 5 63800328 missense probably benign 0.00
R2958:Nwd2 UTSW 5 63805982 missense probably benign 0.01
R3034:Nwd2 UTSW 5 63800103 missense probably damaging 1.00
R3422:Nwd2 UTSW 5 63725193 missense possibly damaging 0.46
R3423:Nwd2 UTSW 5 63800161 missense probably damaging 1.00
R3439:Nwd2 UTSW 5 63804552 missense probably benign 0.00
R4193:Nwd2 UTSW 5 63807465 missense probably damaging 1.00
R4254:Nwd2 UTSW 5 63806546 missense possibly damaging 0.74
R4707:Nwd2 UTSW 5 63794322 missense probably damaging 1.00
R4713:Nwd2 UTSW 5 63804460 missense probably benign 0.00
R4735:Nwd2 UTSW 5 63808251 missense probably benign 0.34
R4744:Nwd2 UTSW 5 63806967 missense probably damaging 1.00
R4795:Nwd2 UTSW 5 63805433 missense probably benign 0.21
R4835:Nwd2 UTSW 5 63807846 missense probably benign 0.00
R4839:Nwd2 UTSW 5 63805550 missense possibly damaging 0.92
R4896:Nwd2 UTSW 5 63804808 missense probably damaging 1.00
R5017:Nwd2 UTSW 5 63650141 utr 5 prime probably benign
R5170:Nwd2 UTSW 5 63806037 missense probably damaging 0.99
R5312:Nwd2 UTSW 5 63806072 nonsense probably null
R5330:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5331:Nwd2 UTSW 5 63806516 missense probably benign 0.02
R5419:Nwd2 UTSW 5 63807708 missense probably benign 0.11
R5434:Nwd2 UTSW 5 63807648 missense probably benign 0.00
R5445:Nwd2 UTSW 5 63805338 missense probably damaging 1.00
R5761:Nwd2 UTSW 5 63725230 missense probably damaging 1.00
R5788:Nwd2 UTSW 5 63807771 missense probably benign 0.00
R5907:Nwd2 UTSW 5 63805983 missense probably damaging 0.99
R5959:Nwd2 UTSW 5 63808070 missense probably benign 0.32
R6002:Nwd2 UTSW 5 63804800 missense probably benign
R6027:Nwd2 UTSW 5 63808220 missense possibly damaging 0.65
R6082:Nwd2 UTSW 5 63805031 missense possibly damaging 0.96
R6163:Nwd2 UTSW 5 63805788 missense probably benign 0.00
R6172:Nwd2 UTSW 5 63806906 missense probably damaging 0.98
R6334:Nwd2 UTSW 5 63800253 missense possibly damaging 0.95
R6447:Nwd2 UTSW 5 63807555 missense probably benign 0.41
R6649:Nwd2 UTSW 5 63725184 missense possibly damaging 0.89
R6855:Nwd2 UTSW 5 63804451 missense probably benign 0.00
R7034:Nwd2 UTSW 5 63804915 missense probably damaging 1.00
R7168:Nwd2 UTSW 5 63807494 missense probably benign 0.04
R7326:Nwd2 UTSW 5 63800409 missense probably damaging 1.00
R7561:Nwd2 UTSW 5 63807091 nonsense probably null
R7576:Nwd2 UTSW 5 63807393 missense probably benign 0.00
R7580:Nwd2 UTSW 5 63808281 missense probably benign 0.05
R7723:Nwd2 UTSW 5 63808004 missense possibly damaging 0.69
R7769:Nwd2 UTSW 5 63804504 missense probably damaging 0.99
RF020:Nwd2 UTSW 5 63805723 nonsense probably null
X0023:Nwd2 UTSW 5 63806963 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTGACATGTGTCCAGTGCTC -3'
(R):5'- TACAAAGCGTTCGTTGTGCC -3'

Sequencing Primer
(F):5'- TGTCCAGTGCTCCCTGGATG -3'
(R):5'- GGCTCGGAATTTTTCAGCTAC -3'
Posted On2015-07-06