Incidental Mutation 'R4384:Tada3'
ID326106
Institutional Source Beutler Lab
Gene Symbol Tada3
Ensembl Gene ENSMUSG00000048930
Gene Nametranscriptional adaptor 3
SynonymsADA3, Tada3l, 1110004B19Rik
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location113366025-113377883 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 113370379 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Serine at position 117 (R117S)
Ref Sequence ENSEMBL: ENSMUSP00000108736 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032410] [ENSMUST00000043333] [ENSMUST00000099118]
Predicted Effect probably damaging
Transcript: ENSMUST00000032410
AA Change: R317S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032410
Gene: ENSMUSG00000048930
AA Change: R317S

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Pfam:Ada3 309 430 1e-27 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000043333
AA Change: R298S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043363
Gene: ENSMUSG00000048930
AA Change: R298S

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Pfam:Ada3 289 413 2e-31 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000099118
AA Change: R117S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108736
Gene: ENSMUSG00000048930
AA Change: R117S

DomainStartEndE-ValueType
Pfam:Ada3 108 232 6.7e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113106
SMART Domains Protein: ENSMUSP00000108730
Gene: ENSMUSG00000048930

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000113107
SMART Domains Protein: ENSMUSP00000108731
Gene: ENSMUSG00000048930

DomainStartEndE-ValueType
coiled coil region 47 67 N/A INTRINSIC
low complexity region 108 121 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125414
Meta Mutation Damage Score 0.8398 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA-binding transcriptional activator proteins increase the rate of transcription by interacting with the transcriptional machinery bound to the basal promoter in conjunction with adaptor proteins, possibly by acetylation and destabilization of nucleosomes. The protein encoded by this gene is a transcriptional activator adaptor and a component of the histone acetyl transferase (HAT) coactivator complex which plays a crucial role in chromatin modulation and cell cycle progression. Along with the other components of the complex, this protein links transcriptional activators bound to specific promoters, to histone acetylation and the transcriptional machinery. The protein is also involved in the stabilization and activation of the p53 tumor suppressor protein that plays a role in the cellular response to DNA damage. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 associated with impaired proliferation of trophoblast cells and absence of inner cell mass. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Tada3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Tada3 APN 6 113376012 missense probably benign 0.41
IGL03256:Tada3 APN 6 113375131 missense possibly damaging 0.83
R0208:Tada3 UTSW 6 113367007 missense probably damaging 1.00
R0542:Tada3 UTSW 6 113375214 missense probably damaging 0.99
R0698:Tada3 UTSW 6 113367007 missense probably damaging 1.00
R2120:Tada3 UTSW 6 113371015 missense possibly damaging 0.50
R7844:Tada3 UTSW 6 113370960 missense probably benign 0.05
R7927:Tada3 UTSW 6 113370960 missense probably benign 0.05
Predicted Primers PCR Primer
(F):5'- TCTGAGACACAACCTAGGGC -3'
(R):5'- TGTGCCATGAAACAGTGAAAAC -3'

Sequencing Primer
(F):5'- ACAGGACTGCTTGGTGACG -3'
(R):5'- ACTTACGAGTTACATAAAATTGGGG -3'
Posted On2015-07-06