Mutagenetix > Incidental Mutation

Incidental Mutation 'R4384:Tada3'

326106

Institutional Source

Beutler Lab

Gene Symbol

Tada3

Ensembl Gene

ENSMUSG00000048930

Gene Name

transcriptional adaptor 3

Synonyms

1110004B19Rik, ADA3, Tada3l

MMRRC Submission

042002-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4384 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

113343594-113354799 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 113347340 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Serine at position 117 (R117S)

Ref Sequence

ENSEMBL: ENSMUSP00000108736 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000032410] [ENSMUST00000043333] [ENSMUST00000099118]

AlphaFold

Q8R0L9

Predicted Effect

probably damaging
Transcript: ENSMUST00000032410
AA Change: R317S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000032410
Gene: ENSMUSG00000048930
AA Change: R317S

Domain	Start	End	E-Value	Type
coiled coil region	47	67	N/A	INTRINSIC
low complexity region	108	121	N/A	INTRINSIC
Pfam:Ada3	309	430	1e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000043333
AA Change: R298S

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000043363
Gene: ENSMUSG00000048930
AA Change: R298S

Domain	Start	End	E-Value	Type
coiled coil region	47	67	N/A	INTRINSIC
low complexity region	108	121	N/A	INTRINSIC
Pfam:Ada3	289	413	2e-31	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000099118
AA Change: R117S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000108736
Gene: ENSMUSG00000048930
AA Change: R117S

Domain	Start	End	E-Value	Type
Pfam:Ada3	108	232	6.7e-33	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000113106

SMART Domains

Protein: ENSMUSP00000108730
Gene: ENSMUSG00000048930

Domain	Start	End	E-Value	Type
coiled coil region	47	67	N/A	INTRINSIC
low complexity region	108	121	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000113107

SMART Domains

Protein: ENSMUSP00000108731
Gene: ENSMUSG00000048930

Domain	Start	End	E-Value	Type
coiled coil region	47	67	N/A	INTRINSIC
low complexity region	108	121	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000125414

Meta Mutation Damage Score

0.8398

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA-binding transcriptional activator proteins increase the rate of transcription by interacting with the transcriptional machinery bound to the basal promoter in conjunction with adaptor proteins, possibly by acetylation and destabilization of nucleosomes. The protein encoded by this gene is a transcriptional activator adaptor and a component of the histone acetyl transferase (HAT) coactivator complex which plays a crucial role in chromatin modulation and cell cycle progression. Along with the other components of the complex, this protein links transcriptional activators bound to specific promoters, to histone acetylation and the transcriptional machinery. The protein is also involved in the stabilization and activation of the p53 tumor suppressor protein that plays a role in the cellular response to DNA damage. Alternate splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality between E3.5 and E8.5 associated with impaired proliferation of trophoblast cells and absence of inner cell mass. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,792,805 (GRCm39)	V27E	possibly damaging	Het
Adam23	T	C	1: 63,605,787 (GRCm39)	Y624H	probably damaging	Het
Arhgef10	T	A	8: 14,980,157 (GRCm39)	C132*	probably null	Het
Boc	A	T	16: 44,311,545 (GRCm39)	L726H	probably damaging	Het
Brip1	A	T	11: 86,039,255 (GRCm39)	D426E	possibly damaging	Het
Cadps2	T	A	6: 23,412,987 (GRCm39)	Q654L	probably benign	Het
Calr3	T	A	8: 73,182,008 (GRCm39)	D120V	probably damaging	Het
Cntnap3	A	G	13: 64,896,274 (GRCm39)	Y1067H	probably damaging	Het
Csnk1g1	T	C	9: 65,927,190 (GRCm39)	V119A	probably damaging	Het
Ddias	G	A	7: 92,507,431 (GRCm39)	T828I	probably damaging	Het
Dennd4c	A	G	4: 86,729,687 (GRCm39)	Y763C	probably damaging	Het
Dscam	T	A	16: 96,510,416 (GRCm39)	I948F	probably damaging	Het
E030018B13Rik	A	G	7: 63,569,141 (GRCm39)		probably benign	Het
E2f8	G	A	7: 48,516,847 (GRCm39)	T844I	possibly damaging	Het
Eps8	T	A	6: 137,476,590 (GRCm39)	H603L	probably benign	Het
Esrrg	G	A	1: 187,775,908 (GRCm39)	C122Y	probably damaging	Het
Frmd4a	C	T	2: 4,599,374 (GRCm39)	R467*	probably null	Het
Gad2	G	A	2: 22,575,422 (GRCm39)	V509I	probably benign	Het
Gpat4	A	G	8: 23,664,602 (GRCm39)	I446T	probably benign	Het
Klhl12	T	G	1: 134,415,392 (GRCm39)	D435E	probably damaging	Het
Luc7l	T	C	17: 26,498,936 (GRCm39)		probably benign	Het
Marchf2	C	A	17: 33,915,167 (GRCm39)	M142I	probably benign	Het
Marf1	T	A	16: 13,960,505 (GRCm39)	Y513F	possibly damaging	Het
Mdm2	T	C	10: 117,532,344 (GRCm39)	D114G	possibly damaging	Het
Med1	G	A	11: 98,043,688 (GRCm39)		probably benign	Het
Meikin	C	T	11: 54,308,613 (GRCm39)	Q404*	probably null	Het
Myh9	A	T	15: 77,675,912 (GRCm39)		probably benign	Het
Mylip	T	C	13: 45,543,434 (GRCm39)	M1T	probably null	Het
Ncapg2	T	C	12: 116,403,497 (GRCm39)		probably null	Het
Nmd3	T	C	3: 69,631,731 (GRCm39)		probably benign	Het
Nwd2	T	A	5: 63,963,914 (GRCm39)	L1166H	probably damaging	Het
Or1j13	A	G	2: 36,370,010 (GRCm39)	L44P	probably damaging	Het
Or8b48	T	C	9: 38,493,349 (GRCm39)	Y259H	probably damaging	Het
Rubcn	A	G	16: 32,677,272 (GRCm39)	I71T	probably damaging	Het
Rwdd3	T	C	3: 120,952,406 (GRCm39)		probably benign	Het
Ryr2	T	C	13: 11,620,119 (GRCm39)	E3826G	probably damaging	Het
Sdad1	T	C	5: 92,446,116 (GRCm39)	Q273R	probably benign	Het
Sdha	A	T	13: 74,475,104 (GRCm39)	I579K	possibly damaging	Het
Sema4d	A	G	13: 51,856,919 (GRCm39)	L771P	probably damaging	Het
Shroom3	G	T	5: 93,090,945 (GRCm39)	V1151F	probably damaging	Het
Slc6a11	A	G	6: 114,224,688 (GRCm39)	E624G	possibly damaging	Het
Tm9sf3	T	C	19: 41,236,372 (GRCm39)	M130V	probably damaging	Het
Trpc1	C	A	9: 95,614,161 (GRCm39)	M34I	probably benign	Het
Trpc4ap	A	G	2: 155,482,427 (GRCm39)	V521A	possibly damaging	Het
Trpm2	A	G	10: 77,753,559 (GRCm39)	V1315A	probably benign	Het
Tvp23a	A	G	16: 10,246,546 (GRCm39)	S80P	probably benign	Het
Usp54	A	T	14: 20,600,153 (GRCm39)		probably null	Het
Vmn2r27	A	G	6: 124,201,115 (GRCm39)	Y281H	probably benign	Het
Vwf	T	A	6: 125,632,079 (GRCm39)	I37N	unknown	Het
Zfp329	G	A	7: 12,545,584 (GRCm39)		probably benign	Het
Zfp616	G	T	11: 73,974,005 (GRCm39)	L91F	possibly damaging	Het

Other mutations in Tada3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01635:Tada3	APN	6	113,352,973 (GRCm39)	missense	probably benign	0.41
IGL03256:Tada3	APN	6	113,352,092 (GRCm39)	missense	possibly damaging	0.83
R0208:Tada3	UTSW	6	113,343,968 (GRCm39)	missense	probably damaging	1.00
R0542:Tada3	UTSW	6	113,352,175 (GRCm39)	missense	probably damaging	0.99
R0698:Tada3	UTSW	6	113,343,968 (GRCm39)	missense	probably damaging	1.00
R2120:Tada3	UTSW	6	113,347,976 (GRCm39)	missense	possibly damaging	0.50
R7844:Tada3	UTSW	6	113,347,921 (GRCm39)	missense	probably benign	0.05
R8402:Tada3	UTSW	6	113,351,774 (GRCm39)	missense	probably damaging	1.00
R9289:Tada3	UTSW	6	113,347,264 (GRCm39)	missense	possibly damaging	0.92
R9771:Tada3	UTSW	6	113,349,319 (GRCm39)	missense	probably benign	0.01
Z1176:Tada3	UTSW	6	113,352,823 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGAGACACAACCTAGGGC -3'
(R):5'- TGTGCCATGAAACAGTGAAAAC -3'

Sequencing Primer
(F):5'- ACAGGACTGCTTGGTGACG -3'
(R):5'- ACTTACGAGTTACATAAAATTGGGG -3'

Posted On

2015-07-06