Incidental Mutation 'R4384:Slc6a11'
ID326107
Institutional Source Beutler Lab
Gene Symbol Slc6a11
Ensembl Gene ENSMUSG00000030307
Gene Namesolute carrier family 6 (neurotransmitter transporter, GABA), member 11
SynonymsGabt4, E130202I16Rik, Gat3, D930045G19Rik, GAT4
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location114131241-114249952 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 114247727 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 624 (E624G)
Ref Sequence ENSEMBL: ENSMUSP00000032451 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032451]
Predicted Effect possibly damaging
Transcript: ENSMUST00000032451
AA Change: E624G

PolyPhen 2 Score 0.467 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000032451
Gene: ENSMUSG00000030307
AA Change: E624G

DomainStartEndE-ValueType
low complexity region 25 33 N/A INTRINSIC
Pfam:SNF 45 571 4.1e-250 PFAM
Meta Mutation Damage Score 0.0921 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a sodium-dependent transporter that uptakes gamma-aminobutyric acid (GABA), an inhibitory neurotransmitter, which ends the GABA neurotransmission. Defects in this gene may result in epilepsy, behavioral problems, or intellectual problems. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2015]
PHENOTYPE: Mice homozygous for a targeted mutation display postnatal lethality. Mice heterozygous for a targeted mutation display resistance to pharmacologically induced seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Slc6a11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01303:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01306:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01308:Slc6a11 APN 6 114134665 missense probably damaging 1.00
IGL01616:Slc6a11 APN 6 114134868 missense possibly damaging 0.93
IGL01985:Slc6a11 APN 6 114134892 missense probably benign 0.43
IGL02270:Slc6a11 APN 6 114238396 missense probably damaging 1.00
IGL02692:Slc6a11 APN 6 114162139 missense probably damaging 1.00
IGL02828:Slc6a11 APN 6 114134987 missense possibly damaging 0.53
IGL03135:Slc6a11 APN 6 114194609 critical splice acceptor site probably null
ANU23:Slc6a11 UTSW 6 114134665 missense probably damaging 1.00
R0603:Slc6a11 UTSW 6 114244890 missense probably benign 0.03
R1147:Slc6a11 UTSW 6 114244870 missense possibly damaging 0.90
R1147:Slc6a11 UTSW 6 114244870 missense possibly damaging 0.90
R1219:Slc6a11 UTSW 6 114225811 splice site probably benign
R1226:Slc6a11 UTSW 6 114194663 missense possibly damaging 0.93
R1676:Slc6a11 UTSW 6 114247666 missense probably benign
R2231:Slc6a11 UTSW 6 114194629 missense probably damaging 1.00
R2297:Slc6a11 UTSW 6 114131425 missense probably benign 0.37
R4556:Slc6a11 UTSW 6 114244812 missense probably benign 0.00
R4564:Slc6a11 UTSW 6 114131362 missense probably benign 0.00
R5488:Slc6a11 UTSW 6 114243894 missense probably damaging 1.00
R5736:Slc6a11 UTSW 6 114162162 missense probably damaging 1.00
R6021:Slc6a11 UTSW 6 114230051 missense probably damaging 1.00
R6150:Slc6a11 UTSW 6 114245618 missense probably benign 0.08
R6733:Slc6a11 UTSW 6 114134898 missense probably damaging 1.00
R7391:Slc6a11 UTSW 6 114238461 missense probably benign
R7451:Slc6a11 UTSW 6 114245683 nonsense probably null
R7750:Slc6a11 UTSW 6 114230137 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CATCTATATTGCTGGGGAGGCAG -3'
(R):5'- CACTATCACTGGGAAGAGGC -3'

Sequencing Primer
(F):5'- ATGGACAGACCTGGCACC -3'
(R):5'- CAAGGGTACAGGGCACAC -3'
Posted On2015-07-06