Incidental Mutation 'R4384:E2f8'
ID326112
Institutional Source Beutler Lab
Gene Symbol E2f8
Ensembl Gene ENSMUSG00000046179
Gene NameE2F transcription factor 8
Synonyms4432406C08Rik
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location48866429-48881596 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48867099 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 844 (T844I)
Ref Sequence ENSEMBL: ENSMUSP00000112883 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058745] [ENSMUST00000119223]
Predicted Effect possibly damaging
Transcript: ENSMUST00000058745
AA Change: T844I

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056778
Gene: ENSMUSG00000046179
AA Change: T844I

DomainStartEndE-ValueType
E2F_TDP 113 182 4.25e-29 SMART
E2F_TDP 261 347 2.26e-33 SMART
low complexity region 819 832 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000119223
AA Change: T844I

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000112883
Gene: ENSMUSG00000046179
AA Change: T844I

DomainStartEndE-ValueType
Pfam:E2F_TDP 113 182 8.9e-24 PFAM
Pfam:E2F_TDP 261 347 3e-21 PFAM
low complexity region 819 832 N/A INTRINSIC
Meta Mutation Damage Score 0.1121 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of transcription factors which regulate the expression of genes required for progression through the cell cycle. The encoded protein regulates progression from G1 to S phase by ensuring the nucleus divides at the proper time. Multiple alternatively spliced variants, encoding the same protein, have been identified. [provided by RefSeq, Jan 2012]
PHENOTYPE: Mice homozygous for a knock-out allele develop normally through puberty and live to old age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in E2f8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00832:E2f8 APN 7 48868203 missense probably damaging 1.00
IGL01121:E2f8 APN 7 48867821 nonsense probably null
IGL01351:E2f8 APN 7 48867151 missense probably benign 0.00
IGL01592:E2f8 APN 7 48867857 missense probably damaging 1.00
IGL01730:E2f8 APN 7 48877934 splice site probably benign
IGL02708:E2f8 APN 7 48867234 splice site probably null
R0535:E2f8 UTSW 7 48871810 splice site probably benign
R1356:E2f8 UTSW 7 48880270 splice site probably benign
R1902:E2f8 UTSW 7 48871172 missense probably benign 0.32
R1989:E2f8 UTSW 7 48873280 missense probably benign 0.30
R2109:E2f8 UTSW 7 48875107 missense probably damaging 1.00
R4126:E2f8 UTSW 7 48875607 missense probably damaging 0.99
R4817:E2f8 UTSW 7 48867746 missense probably benign
R4939:E2f8 UTSW 7 48872138 missense probably benign 0.02
R4979:E2f8 UTSW 7 48875170 intron probably benign
R5274:E2f8 UTSW 7 48867177 missense probably damaging 0.97
R5624:E2f8 UTSW 7 48877961 missense probably damaging 1.00
R5677:E2f8 UTSW 7 48867195 missense probably damaging 0.99
R5940:E2f8 UTSW 7 48871077 missense probably benign 0.03
R5988:E2f8 UTSW 7 48874995 missense probably damaging 1.00
R6003:E2f8 UTSW 7 48870777 missense probably benign
R6107:E2f8 UTSW 7 48867676 missense probably benign 0.01
R6816:E2f8 UTSW 7 48875583 missense possibly damaging 0.46
R7329:E2f8 UTSW 7 48872110 missense probably damaging 1.00
R7343:E2f8 UTSW 7 48867965 missense probably damaging 0.97
R7444:E2f8 UTSW 7 48868179 missense probably damaging 0.98
R7474:E2f8 UTSW 7 48875760 missense probably damaging 1.00
R7793:E2f8 UTSW 7 48878075 missense probably benign 0.00
Z1177:E2f8 UTSW 7 48875546 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- ATGCGCATGTGTGTATATCTGC -3'
(R):5'- TAGTCTCCCAGCAATCCAGATATC -3'

Sequencing Primer
(F):5'- CTGCTGTGATATTGAGTAAAAACCCC -3'
(R):5'- CCAGCAATCCAGATATCATTTAGCTG -3'
Posted On2015-07-06