Incidental Mutation 'R4384:Gpat4'
ID326116
Institutional Source Beutler Lab
Gene Symbol Gpat4
Ensembl Gene ENSMUSG00000031545
Gene Nameglycerol-3-phosphate acyltransferase 4
SynonymsAgpat6
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.355) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location23171265-23208346 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 23174586 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 446 (I446T)
Ref Sequence ENSEMBL: ENSMUSP00000127325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167004]
Predicted Effect probably benign
Transcript: ENSMUST00000167004
AA Change: I446T

PolyPhen 2 Score 0.054 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000127325
Gene: ENSMUSG00000031545
AA Change: I446T

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
transmembrane domain 156 175 N/A INTRINSIC
transmembrane domain 180 202 N/A INTRINSIC
PlsC 242 353 9.31e-24 SMART
Blast:PlsC 368 413 7e-18 BLAST
low complexity region 414 425 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210782
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210992
Meta Mutation Damage Score 0.1041 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Lysophosphatidic acid acyltransferases (EC 2.3.1.51) catalyze the conversion of lysophosphatidic acid (LPA) to phosphatidic acid (PA). LPA and PA are involved in signal transduction and lipid biosynthesis.[supplied by OMIM, Apr 2004]
PHENOTYPE: Nursing mothers homozygous for a gene trap allele display underdeveloped mammary glands that are depleted in intracellular fat droplets and lack the ability to produce diacylglycerol- and triacylglycerol-rich milk; pups nursed by mutant mothers die neonatally unless transferred to foster mothers. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Gpat4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00579:Gpat4 APN 8 23182775 missense probably damaging 0.97
IGL01660:Gpat4 APN 8 23175338 critical splice donor site probably null
IGL01688:Gpat4 APN 8 23181845 missense probably benign 0.03
IGL02749:Gpat4 APN 8 23180870 missense probably damaging 1.00
R0076:Gpat4 UTSW 8 23190705 splice site probably benign
R0362:Gpat4 UTSW 8 23180933 missense probably benign 0.05
R0961:Gpat4 UTSW 8 23180911 missense probably damaging 0.96
R1876:Gpat4 UTSW 8 23179470 missense possibly damaging 0.82
R1959:Gpat4 UTSW 8 23182936 missense possibly damaging 0.81
R2217:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2313:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2315:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R2969:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3110:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3112:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3774:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3775:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3826:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3828:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3829:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3830:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3943:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R3944:Gpat4 UTSW 8 23180155 missense probably damaging 0.97
R4685:Gpat4 UTSW 8 23182849 utr 5 prime probably benign
R5120:Gpat4 UTSW 8 23180202 missense possibly damaging 0.77
R5199:Gpat4 UTSW 8 23182696 missense possibly damaging 0.46
R5491:Gpat4 UTSW 8 23180664 missense probably benign 0.38
X0062:Gpat4 UTSW 8 23190711 splice site probably null
X0064:Gpat4 UTSW 8 23175394 missense probably damaging 1.00
Z1176:Gpat4 UTSW 8 23179798 missense not run
Predicted Primers PCR Primer
(F):5'- ATTCTGGTTAGAGGACAGCAGG -3'
(R):5'- GTGTGTCTTGCCAGATTCCC -3'

Sequencing Primer
(F):5'- TGGAGTCCAGAACAGCCTG -3'
(R):5'- CAGATTCCCTGGGGGTTGAGC -3'
Posted On2015-07-06