Incidental Mutation 'R4384:Olfr912'
ID326117
Institutional Source Beutler Lab
Gene Symbol Olfr912
Ensembl Gene ENSMUSG00000111448
Gene Nameolfactory receptor 912
SynonymsMOR165-4, GA_x6K02T2PVTD-32283590-32284522
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.256) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location38580178-38586876 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 38582053 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 259 (Y259H)
Ref Sequence ENSEMBL: ENSMUSP00000150014 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071681] [ENSMUST00000217160]
Predicted Effect probably damaging
Transcript: ENSMUST00000071681
AA Change: Y259H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000071604
Gene: ENSMUSG00000049926
AA Change: Y259H

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 9.8e-51 PFAM
Pfam:7tm_1 41 290 1.3e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000217160
AA Change: Y259H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.6467 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Olfr912
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Olfr912 APN 9 38581376 missense probably damaging 0.97
IGL01099:Olfr912 APN 9 38582077 missense probably benign 0.00
IGL01749:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01750:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01751:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01752:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL01753:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02262:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02264:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02298:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02305:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02309:Olfr912 APN 9 38581433 missense probably damaging 1.00
IGL02309:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02317:Olfr912 APN 9 38581513 missense probably damaging 1.00
IGL02401:Olfr912 APN 9 38581355 missense probably damaging 1.00
R0311:Olfr912 UTSW 9 38539297 missense probably benign 0.42
R0973:Olfr912 UTSW 9 38581283 missense possibly damaging 0.74
R1552:Olfr912 UTSW 9 38581379 missense probably benign 0.00
R1720:Olfr912 UTSW 9 38581289 missense probably benign
R2149:Olfr912 UTSW 9 38581508 missense probably benign 0.02
R2241:Olfr912 UTSW 9 38581805 missense probably damaging 1.00
R3622:Olfr912 UTSW 9 38581496 missense probably damaging 1.00
R4686:Olfr912 UTSW 9 38582031 missense probably damaging 1.00
R4780:Olfr912 UTSW 9 38581969 missense possibly damaging 0.84
R5221:Olfr912 UTSW 9 38581852 missense probably damaging 1.00
R5503:Olfr912 UTSW 9 38582072 missense probably benign
R5887:Olfr912 UTSW 9 38581784 missense probably damaging 1.00
R6062:Olfr912 UTSW 9 38539144 missense probably damaging 0.97
R6516:Olfr912 UTSW 9 38581472 missense probably damaging 1.00
R6542:Olfr912 UTSW 9 38539437 missense probably benign 0.01
R6766:Olfr912 UTSW 9 38581773 missense probably damaging 1.00
R7057:Olfr912 UTSW 9 38581754 missense probably damaging 1.00
R7112:Olfr912 UTSW 9 38582034 nonsense probably null
R7414:Olfr912 UTSW 9 38581468 missense probably benign 0.00
R7514:Olfr912 UTSW 9 38582051 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCACAAGCACCTATATAAATGAGGTAG -3'
(R):5'- CTTGCATTTGACACAGCTGTC -3'

Sequencing Primer
(F):5'- AATGAGGTAGAGATTTTCATTGTAGG -3'
(R):5'- CTCAGGGCAAGTTTAACATC -3'
Posted On2015-07-06