Mutagenetix > Incidental Mutations

Incidental Mutation 'R4384:Olfr912'

326117

Institutional Source

Beutler Lab

Gene Symbol

Olfr912

Ensembl Gene

ENSMUSG00000111448

Gene Name

olfactory receptor 912

Synonyms

MOR165-4, GA_x6K02T2PVTD-32283590-32284522

MMRRC Submission

042002-MU

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.256) question?

Stock #

R4384 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

38580178-38586876 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 38582053 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 259 (Y259H)

Ref Sequence

ENSEMBL: ENSMUSP00000150014 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000071681] [ENSMUST00000217160]

Predicted Effect

probably damaging
Transcript: ENSMUST00000071681
AA Change: Y259H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000071604
Gene: ENSMUSG00000049926
AA Change: Y259H

Domain	Start	End	E-Value	Type
Pfam:7tm_4	31	308	9.8e-51	PFAM
Pfam:7tm_1	41	290	1.3e-21	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000217160
AA Change: Y259H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Meta Mutation Damage Score

0.6467

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,568	V27E	possibly damaging	Het
Adam23	T	C	1: 63,566,628	Y624H	probably damaging	Het
Arhgef10	T	A	8: 14,930,157	C132*	probably null	Het
Boc	A	T	16: 44,491,182	L726H	probably damaging	Het
Brip1	A	T	11: 86,148,429	D426E	possibly damaging	Het
Cadps2	T	A	6: 23,412,988	Q654L	probably benign	Het
Calr3	T	A	8: 72,428,164	D120V	probably damaging	Het
Cntnap3	A	G	13: 64,748,460	Y1067H	probably damaging	Het
Csnk1g1	T	C	9: 66,019,908	V119A	probably damaging	Het
Ddias	G	A	7: 92,858,223	T828I	probably damaging	Het
Dennd4c	A	G	4: 86,811,450	Y763C	probably damaging	Het
Dscam	T	A	16: 96,709,216	I948F	probably damaging	Het
E030018B13Rik	A	G	7: 63,919,393		probably benign	Het
E2f8	G	A	7: 48,867,099	T844I	possibly damaging	Het
Eps8	T	A	6: 137,499,592	H603L	probably benign	Het
Esrrg	G	A	1: 188,043,711	C122Y	probably damaging	Het
Frmd4a	C	T	2: 4,594,563	R467*	probably null	Het
Gad2	G	A	2: 22,685,410	V509I	probably benign	Het
Gpat4	A	G	8: 23,174,586	I446T	probably benign	Het
Klhl12	T	G	1: 134,487,654	D435E	probably damaging	Het
Luc7l	T	C	17: 26,279,962		probably benign	Het
March2	C	A	17: 33,696,193	M142I	probably benign	Het
Marf1	T	A	16: 14,142,641	Y513F	possibly damaging	Het
Mdm2	T	C	10: 117,696,439	D114G	possibly damaging	Het
Med1	G	A	11: 98,152,862		probably benign	Het
Meikin	C	T	11: 54,417,787	Q404*	probably null	Het
Myh9	A	T	15: 77,791,712		probably benign	Het
Mylip	T	C	13: 45,389,958	M1T	probably null	Het
Ncapg2	T	C	12: 116,439,877		probably null	Het
Nmd3	T	C	3: 69,724,398		probably benign	Het
Nwd2	T	A	5: 63,806,571	L1166H	probably damaging	Het
Olfr341	A	G	2: 36,479,998	L44P	probably damaging	Het
Rubcn	A	G	16: 32,856,902	I71T	probably damaging	Het
Rwdd3	T	C	3: 121,158,757		probably benign	Het
Ryr2	T	C	13: 11,605,233	E3826G	probably damaging	Het
Sdad1	T	C	5: 92,298,257	Q273R	probably benign	Het
Sdha	A	T	13: 74,326,985	I579K	possibly damaging	Het
Sema4d	A	G	13: 51,702,883	L771P	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc6a11	A	G	6: 114,247,727	E624G	possibly damaging	Het
Tada3	G	T	6: 113,370,379	R117S	probably damaging	Het
Tm9sf3	T	C	19: 41,247,933	M130V	probably damaging	Het
Trpc1	C	A	9: 95,732,108	M34I	probably benign	Het
Trpc4ap	A	G	2: 155,640,507	V521A	possibly damaging	Het
Trpm2	A	G	10: 77,917,725	V1315A	probably benign	Het
Tvp23a	A	G	16: 10,428,682	S80P	probably benign	Het
Usp54	A	T	14: 20,550,085		probably null	Het
Vmn2r27	A	G	6: 124,224,156	Y281H	probably benign	Het
Vwf	T	A	6: 125,655,116	I37N	unknown	Het
Zfp329	G	A	7: 12,811,657		probably benign	Het
Zfp616	G	T	11: 74,083,179	L91F	possibly damaging	Het

Other mutations in Olfr912

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00913:Olfr912	APN	9	38581376	missense	probably damaging	0.97
IGL01099:Olfr912	APN	9	38582077	missense	probably benign	0.00
IGL01749:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL01750:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL01751:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL01752:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL01753:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02262:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02264:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02298:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02305:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02309:Olfr912	APN	9	38581433	missense	probably damaging	1.00
IGL02309:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02317:Olfr912	APN	9	38581513	missense	probably damaging	1.00
IGL02401:Olfr912	APN	9	38581355	missense	probably damaging	1.00
R0311:Olfr912	UTSW	9	38539297	missense	probably benign	0.42
R0973:Olfr912	UTSW	9	38581283	missense	possibly damaging	0.74
R1552:Olfr912	UTSW	9	38581379	missense	probably benign	0.00
R1720:Olfr912	UTSW	9	38581289	missense	probably benign
R2149:Olfr912	UTSW	9	38581508	missense	probably benign	0.02
R2241:Olfr912	UTSW	9	38581805	missense	probably damaging	1.00
R3622:Olfr912	UTSW	9	38581496	missense	probably damaging	1.00
R4686:Olfr912	UTSW	9	38582031	missense	probably damaging	1.00
R4780:Olfr912	UTSW	9	38581969	missense	possibly damaging	0.84
R5221:Olfr912	UTSW	9	38581852	missense	probably damaging	1.00
R5503:Olfr912	UTSW	9	38582072	missense	probably benign
R5887:Olfr912	UTSW	9	38581784	missense	probably damaging	1.00
R6062:Olfr912	UTSW	9	38539144	missense	probably damaging	0.97
R6516:Olfr912	UTSW	9	38581472	missense	probably damaging	1.00
R6542:Olfr912	UTSW	9	38539437	missense	probably benign	0.01
R6766:Olfr912	UTSW	9	38581773	missense	probably damaging	1.00
R7057:Olfr912	UTSW	9	38581754	missense	probably damaging	1.00
R7112:Olfr912	UTSW	9	38582034	nonsense	probably null
R7414:Olfr912	UTSW	9	38581468	missense	probably benign	0.00
R7514:Olfr912	UTSW	9	38582051	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- GCACAAGCACCTATATAAATGAGGTAG -3'
(R):5'- CTTGCATTTGACACAGCTGTC -3'

Sequencing Primer
(F):5'- AATGAGGTAGAGATTTTCATTGTAGG -3'
(R):5'- CTCAGGGCAAGTTTAACATC -3'

Posted On

2015-07-06