Mutagenetix > Incidental Mutations

Incidental Mutation 'R4384:Trpc1'

326119

Institutional Source

Beutler Lab

Gene Symbol

Trpc1

Ensembl Gene

ENSMUSG00000032839

Gene Name

transient receptor potential cation channel, subfamily C, member 1

Synonyms

Trrp1, Mtrp1, Trp1

MMRRC Submission

042002-MU

Accession Numbers

Is this an essential gene?

Probably non essential (E-score: 0.181) question?

Stock #

R4384 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

95705082-95750375 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 95732108 bp

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 34 (M34I)

Ref Sequence

ENSEMBL: ENSMUSP00000140994 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000053785] [ENSMUST00000186235] [ENSMUST00000189137] [ENSMUST00000190497] [ENSMUST00000190604]

Predicted Effect

probably benign
Transcript: ENSMUST00000053785
AA Change: M159I

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000057640
Gene: ENSMUSG00000032839
AA Change: M159I

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC
ANK	62	93	1.41e2	SMART
ANK	99	129	2.11e1	SMART
ANK	174	203	1.33e2	SMART
Pfam:TRP_2	209	271	2.6e-27	PFAM
transmembrane domain	367	386	N/A	INTRINSIC
Pfam:Ion_trans	407	673	5.9e-17	PFAM
coiled coil region	770	794	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000186235
AA Change: M34I

PolyPhen 2 Score 0.131 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000140994
Gene: ENSMUSG00000032839
AA Change: M34I

Domain	Start	End	E-Value	Type
Blast:ANK	15	44	7e-12	BLAST
Pfam:TRP_2	50	105	1e-18	PFAM
transmembrane domain	201	222	N/A	INTRINSIC
transmembrane domain	237	254	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000189137
AA Change: M193I

PolyPhen 2 Score 0.033 (Sensitivity: 0.95; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000139672
Gene: ENSMUSG00000032839
AA Change: M193I

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC
ANK	62	93	1.41e2	SMART
ANK	99	129	2.11e1	SMART
ANK	174	203	1.33e2	SMART
Pfam:TRP_2	209	271	1.8e-29	PFAM
transmembrane domain	367	386	N/A	INTRINSIC
transmembrane domain	407	424	N/A	INTRINSIC
Pfam:Ion_trans	441	661	1.2e-21	PFAM
coiled coil region	770	794	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190497

SMART Domains

Protein: ENSMUSP00000140550
Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000190604

SMART Domains

Protein: ENSMUSP00000139577
Gene: ENSMUSG00000032839

Domain	Start	End	E-Value	Type
low complexity region	4	13	N/A	INTRINSIC
low complexity region	31	44	N/A	INTRINSIC

Meta Mutation Damage Score

0.0909

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a membrane protein that can form a non-selective channel permeable to calcium and other cations. The encoded protein appears to be induced to form channels by a receptor tyrosine kinase-activated phosphatidylinositol second messenger system and also by depletion of intracellular calcium stores. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased body weight and a severe loss of salivary gland fluid secretion due to attenuation of store-operated Ca2+ currents. Surprisingly, no abnormalities are seen in store-operated or mechanosensitive cation channels in vascular smooth muscle cells. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,568	V27E	possibly damaging	Het
Adam23	T	C	1: 63,566,628	Y624H	probably damaging	Het
Arhgef10	T	A	8: 14,930,157	C132*	probably null	Het
Boc	A	T	16: 44,491,182	L726H	probably damaging	Het
Brip1	A	T	11: 86,148,429	D426E	possibly damaging	Het
Cadps2	T	A	6: 23,412,988	Q654L	probably benign	Het
Calr3	T	A	8: 72,428,164	D120V	probably damaging	Het
Cntnap3	A	G	13: 64,748,460	Y1067H	probably damaging	Het
Csnk1g1	T	C	9: 66,019,908	V119A	probably damaging	Het
Ddias	G	A	7: 92,858,223	T828I	probably damaging	Het
Dennd4c	A	G	4: 86,811,450	Y763C	probably damaging	Het
Dscam	T	A	16: 96,709,216	I948F	probably damaging	Het
E030018B13Rik	A	G	7: 63,919,393		probably benign	Het
E2f8	G	A	7: 48,867,099	T844I	possibly damaging	Het
Eps8	T	A	6: 137,499,592	H603L	probably benign	Het
Esrrg	G	A	1: 188,043,711	C122Y	probably damaging	Het
Frmd4a	C	T	2: 4,594,563	R467*	probably null	Het
Gad2	G	A	2: 22,685,410	V509I	probably benign	Het
Gpat4	A	G	8: 23,174,586	I446T	probably benign	Het
Klhl12	T	G	1: 134,487,654	D435E	probably damaging	Het
Luc7l	T	C	17: 26,279,962		probably benign	Het
March2	C	A	17: 33,696,193	M142I	probably benign	Het
Marf1	T	A	16: 14,142,641	Y513F	possibly damaging	Het
Mdm2	T	C	10: 117,696,439	D114G	possibly damaging	Het
Med1	G	A	11: 98,152,862		probably benign	Het
Meikin	C	T	11: 54,417,787	Q404*	probably null	Het
Myh9	A	T	15: 77,791,712		probably benign	Het
Mylip	T	C	13: 45,389,958	M1T	probably null	Het
Ncapg2	T	C	12: 116,439,877		probably null	Het
Nmd3	T	C	3: 69,724,398		probably benign	Het
Nwd2	T	A	5: 63,806,571	L1166H	probably damaging	Het
Olfr341	A	G	2: 36,479,998	L44P	probably damaging	Het
Olfr912	T	C	9: 38,582,053	Y259H	probably damaging	Het
Rubcn	A	G	16: 32,856,902	I71T	probably damaging	Het
Rwdd3	T	C	3: 121,158,757		probably benign	Het
Ryr2	T	C	13: 11,605,233	E3826G	probably damaging	Het
Sdad1	T	C	5: 92,298,257	Q273R	probably benign	Het
Sdha	A	T	13: 74,326,985	I579K	possibly damaging	Het
Sema4d	A	G	13: 51,702,883	L771P	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc6a11	A	G	6: 114,247,727	E624G	possibly damaging	Het
Tada3	G	T	6: 113,370,379	R117S	probably damaging	Het
Tm9sf3	T	C	19: 41,247,933	M130V	probably damaging	Het
Trpc4ap	A	G	2: 155,640,507	V521A	possibly damaging	Het
Trpm2	A	G	10: 77,917,725	V1315A	probably benign	Het
Tvp23a	A	G	16: 10,428,682	S80P	probably benign	Het
Usp54	A	T	14: 20,550,085		probably null	Het
Vmn2r27	A	G	6: 124,224,156	Y281H	probably benign	Het
Vwf	T	A	6: 125,655,116	I37N	unknown	Het
Zfp329	G	A	7: 12,811,657		probably benign	Het
Zfp616	G	T	11: 74,083,179	L91F	possibly damaging	Het

Other mutations in Trpc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01068:Trpc1	APN	9	95726494	missense	probably damaging	1.00
IGL02094:Trpc1	APN	9	95743281	missense	probably damaging	1.00
IGL02412:Trpc1	APN	9	95736861	missense	probably damaging	1.00
IGL02494:Trpc1	APN	9	95708307	missense	probably damaging	1.00
IGL02943:Trpc1	APN	9	95708853	splice site	probably benign
IGL03025:Trpc1	APN	9	95710260	missense	probably damaging	1.00
IGL03221:Trpc1	APN	9	95706900	missense	probably damaging	1.00
Enlarged	UTSW	9	95721471	critical splice acceptor site	probably null
luxus	UTSW	9	95721132	critical splice donor site	probably null
Magnified	UTSW	9	95726437	missense	probably damaging	1.00
PIT4581001:Trpc1	UTSW	9	95736921	missense	probably benign	0.21
R0034:Trpc1	UTSW	9	95749761	missense	probably damaging	0.98
R1973:Trpc1	UTSW	9	95723255	missense	probably benign
R2033:Trpc1	UTSW	9	95706843	missense	probably damaging	0.99
R2117:Trpc1	UTSW	9	95717584	missense	probably damaging	1.00
R2262:Trpc1	UTSW	9	95706933	missense	probably damaging	1.00
R2910:Trpc1	UTSW	9	95749842	missense	probably benign	0.00
R2918:Trpc1	UTSW	9	95723129	missense	probably damaging	1.00
R3156:Trpc1	UTSW	9	95721132	critical splice donor site	probably null
R3427:Trpc1	UTSW	9	95732196	missense	probably benign	0.12
R4093:Trpc1	UTSW	9	95706865	missense	probably benign	0.12
R4787:Trpc1	UTSW	9	95721415	missense	probably benign	0.02
R5327:Trpc1	UTSW	9	95721471	critical splice acceptor site	probably null
R5576:Trpc1	UTSW	9	95721324	missense	probably damaging	0.97
R6320:Trpc1	UTSW	9	95721250	missense	probably damaging	1.00
R6499:Trpc1	UTSW	9	95726437	missense	probably damaging	1.00
R6714:Trpc1	UTSW	9	95723273	missense	probably damaging	1.00
R7179:Trpc1	UTSW	9	95721144	missense	possibly damaging	0.82
R7265:Trpc1	UTSW	9	95708275	missense	probably benign
R8169:Trpc1	UTSW	9	95710270	nonsense	probably null
R8288:Trpc1	UTSW	9	95721381	missense	probably damaging	1.00
R8342:Trpc1	UTSW	9	95726548	missense	probably damaging	1.00
X0026:Trpc1	UTSW	9	95732044	missense	probably benign	0.36
Z1176:Trpc1	UTSW	9	95723216	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- TTCCCCAAGTAAGTGTCATCGAC -3'
(R):5'- GAACTGTAGTATTAGGATGTTGCC -3'

Sequencing Primer
(F):5'- CATCGACAGGTGCTTTGATAC -3'
(R):5'- ATTAGGATGTTGCCTATTGAAGATTG -3'

Posted On

2015-07-06