Mutagenetix > Incidental Mutations

Incidental Mutation 'R4384:Med1'

326124

Institutional Source

Beutler Lab

Gene Symbol

Med1

Ensembl Gene

ENSMUSG00000018160

Gene Name

mediator complex subunit 1

Synonyms

Pparbp, l11Jus15, PBP, TRAP 220, CRSP210, DRIP205, TRAP220

MMRRC Submission

042002-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R4384 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

98152154-98193293 bp(-) (GRCm38)

Type of Mutation

unclassified

DNA Base Change (assembly)

G to A at 98152862 bp

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000119003 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018304] [ENSMUST00000092735] [ENSMUST00000103143] [ENSMUST00000107545] [ENSMUST00000150378]

Predicted Effect

probably benign
Transcript: ENSMUST00000018304

SMART Domains

Protein: ENSMUSP00000018304
Gene: ENSMUSG00000018160

Domain	Start	End	E-Value	Type
Pfam:Med1	18	414	3.7e-112	PFAM
low complexity region	536	559	N/A	INTRINSIC
low complexity region	595	619	N/A	INTRINSIC
low complexity region	667	678	N/A	INTRINSIC
low complexity region	960	981	N/A	INTRINSIC
low complexity region	989	999	N/A	INTRINSIC
low complexity region	1015	1036	N/A	INTRINSIC
low complexity region	1042	1054	N/A	INTRINSIC
low complexity region	1063	1138	N/A	INTRINSIC
low complexity region	1170	1183	N/A	INTRINSIC
low complexity region	1205	1243	N/A	INTRINSIC
low complexity region	1250	1281	N/A	INTRINSIC
low complexity region	1344	1364	N/A	INTRINSIC
low complexity region	1482	1503	N/A	INTRINSIC

Predicted Effect

unknown
Transcript: ENSMUST00000092735
AA Change: T581M

SMART Domains

Protein: ENSMUSP00000090411
Gene: ENSMUSG00000018160
AA Change: T581M

Domain	Start	End	E-Value	Type
Pfam:Med1	33	429	1.2e-113	PFAM
transmembrane domain	585	607	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000103143

SMART Domains

Protein: ENSMUSP00000099432
Gene: ENSMUSG00000020883

Domain	Start	End	E-Value	Type
FBOX	28	68	2.62e-8	SMART
LRR	90	115	2.02e-1	SMART
LRR	116	141	1.77e1	SMART
LRR	142	167	7.9e-4	SMART
LRR_CC	168	193	4.61e-5	SMART
LRR	194	219	7.15e-2	SMART
LRR	220	245	1.67e-2	SMART
LRR	246	271	1.2e-3	SMART
LRR	272	297	2.61e-4	SMART
LRR	298	323	1.26e-2	SMART
LRR_CC	324	349	1.77e-6	SMART
LRR	353	377	6.06e2	SMART
LRR	378	403	2.14e0	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000107545

SMART Domains

Protein: ENSMUSP00000103169
Gene: ENSMUSG00000018160

Domain	Start	End	E-Value	Type
Pfam:Med1	59	426	2.9e-74	PFAM
low complexity region	551	574	N/A	INTRINSIC
low complexity region	610	634	N/A	INTRINSIC
low complexity region	682	693	N/A	INTRINSIC
low complexity region	975	996	N/A	INTRINSIC
low complexity region	1004	1014	N/A	INTRINSIC
low complexity region	1030	1051	N/A	INTRINSIC
low complexity region	1057	1069	N/A	INTRINSIC
low complexity region	1078	1153	N/A	INTRINSIC
low complexity region	1185	1198	N/A	INTRINSIC
low complexity region	1220	1258	N/A	INTRINSIC
low complexity region	1265	1296	N/A	INTRINSIC
low complexity region	1359	1379	N/A	INTRINSIC
low complexity region	1497	1518	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126483

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000135969

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000147933

Predicted Effect

probably benign
Transcript: ENSMUST00000150378

SMART Domains

Protein: ENSMUSP00000119003
Gene: ENSMUSG00000020883

Domain	Start	End	E-Value	Type
FBOX	30	70	2.62e-8	SMART
LRR	92	117	3.69e1	SMART
LRR	121	146	7.9e-4	SMART
LRR_CC	147	172	4.61e-5	SMART
LRR	173	198	7.15e-2	SMART

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The activation of gene transcription is a multistep process that is triggered by factors that recognize transcriptional enhancer sites in DNA. These factors work with co-activators to direct transcriptional initiation by the RNA polymerase II apparatus. The protein encoded by this gene is a subunit of the CRSP (cofactor required for SP1 activation) complex, which, along with TFIID, is required for efficient activation by SP1. This protein is also a component of other multisubunit complexes e.g. thyroid hormone receptor-(TR-) associated proteins which interact with TR and facilitate TR function on DNA templates in conjunction with initiation factors and cofactors. It also regulates p53-dependent apoptosis and it is essential for adipogenesis. This protein is known to have the ability to self-oligomerize. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations have defects of placental vasculature, heart, and lens, arrested erythrocytic differentiation, impaired neuronal development, and die by embryonic day 11.5. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,568	V27E	possibly damaging	Het
Adam23	T	C	1: 63,566,628	Y624H	probably damaging	Het
Arhgef10	T	A	8: 14,930,157	C132*	probably null	Het
Boc	A	T	16: 44,491,182	L726H	probably damaging	Het
Brip1	A	T	11: 86,148,429	D426E	possibly damaging	Het
Cadps2	T	A	6: 23,412,988	Q654L	probably benign	Het
Calr3	T	A	8: 72,428,164	D120V	probably damaging	Het
Cntnap3	A	G	13: 64,748,460	Y1067H	probably damaging	Het
Csnk1g1	T	C	9: 66,019,908	V119A	probably damaging	Het
Ddias	G	A	7: 92,858,223	T828I	probably damaging	Het
Dennd4c	A	G	4: 86,811,450	Y763C	probably damaging	Het
Dscam	T	A	16: 96,709,216	I948F	probably damaging	Het
E030018B13Rik	A	G	7: 63,919,393		probably benign	Het
E2f8	G	A	7: 48,867,099	T844I	possibly damaging	Het
Eps8	T	A	6: 137,499,592	H603L	probably benign	Het
Esrrg	G	A	1: 188,043,711	C122Y	probably damaging	Het
Frmd4a	C	T	2: 4,594,563	R467*	probably null	Het
Gad2	G	A	2: 22,685,410	V509I	probably benign	Het
Gpat4	A	G	8: 23,174,586	I446T	probably benign	Het
Klhl12	T	G	1: 134,487,654	D435E	probably damaging	Het
Luc7l	T	C	17: 26,279,962		probably benign	Het
March2	C	A	17: 33,696,193	M142I	probably benign	Het
Marf1	T	A	16: 14,142,641	Y513F	possibly damaging	Het
Mdm2	T	C	10: 117,696,439	D114G	possibly damaging	Het
Meikin	C	T	11: 54,417,787	Q404*	probably null	Het
Myh9	A	T	15: 77,791,712		probably benign	Het
Mylip	T	C	13: 45,389,958	M1T	probably null	Het
Ncapg2	T	C	12: 116,439,877		probably null	Het
Nmd3	T	C	3: 69,724,398		probably benign	Het
Nwd2	T	A	5: 63,806,571	L1166H	probably damaging	Het
Olfr341	A	G	2: 36,479,998	L44P	probably damaging	Het
Olfr912	T	C	9: 38,582,053	Y259H	probably damaging	Het
Rubcn	A	G	16: 32,856,902	I71T	probably damaging	Het
Rwdd3	T	C	3: 121,158,757		probably benign	Het
Ryr2	T	C	13: 11,605,233	E3826G	probably damaging	Het
Sdad1	T	C	5: 92,298,257	Q273R	probably benign	Het
Sdha	A	T	13: 74,326,985	I579K	possibly damaging	Het
Sema4d	A	G	13: 51,702,883	L771P	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc6a11	A	G	6: 114,247,727	E624G	possibly damaging	Het
Tada3	G	T	6: 113,370,379	R117S	probably damaging	Het
Tm9sf3	T	C	19: 41,247,933	M130V	probably damaging	Het
Trpc1	C	A	9: 95,732,108	M34I	probably benign	Het
Trpc4ap	A	G	2: 155,640,507	V521A	possibly damaging	Het
Trpm2	A	G	10: 77,917,725	V1315A	probably benign	Het
Tvp23a	A	G	16: 10,428,682	S80P	probably benign	Het
Usp54	A	T	14: 20,550,085		probably null	Het
Vmn2r27	A	G	6: 124,224,156	Y281H	probably benign	Het
Vwf	T	A	6: 125,655,116	I37N	unknown	Het
Zfp329	G	A	7: 12,811,657		probably benign	Het
Zfp616	G	T	11: 74,083,179	L91F	possibly damaging	Het

Other mutations in Med1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00556:Med1	APN	11	98155684	intron	probably benign
IGL00690:Med1	APN	11	98169400	missense	possibly damaging	0.94
IGL01087:Med1	APN	11	98180285	missense	probably damaging	1.00
IGL01133:Med1	APN	11	98157986	nonsense	probably null
IGL02223:Med1	APN	11	98157876	missense	probably damaging	1.00
IGL02257:Med1	APN	11	98180270	missense	probably damaging	0.98
IGL02699:Med1	APN	11	98180025	missense	possibly damaging	0.61
IGL02706:Med1	APN	11	98156707	intron	probably benign
IGL02902:Med1	APN	11	98156509	intron	probably benign
IGL02986:Med1	APN	11	98156260	intron	probably benign
IGL03011:Med1	APN	11	98161033	missense	possibly damaging	0.92
IGL03282:Med1	APN	11	98156817	missense	probably damaging	1.00
IGL03303:Med1	APN	11	98158352	missense	probably damaging	1.00
IGL03342:Med1	APN	11	98189180	critical splice donor site	probably null
IGL03410:Med1	APN	11	98189183	missense	possibly damaging	0.62
PIT4453001:Med1	UTSW	11	98158417	missense	probably benign	0.40
R0040:Med1	UTSW	11	98166255	critical splice donor site	probably null
R0206:Med1	UTSW	11	98155689	intron	probably benign
R0206:Med1	UTSW	11	98155689	intron	probably benign
R0208:Med1	UTSW	11	98155689	intron	probably benign
R0310:Med1	UTSW	11	98167574	missense	probably benign	0.38
R0505:Med1	UTSW	11	98156904	missense	probably damaging	1.00
R0597:Med1	UTSW	11	98169438	missense	probably benign	0.08
R0680:Med1	UTSW	11	98180166	splice site	probably null
R0686:Med1	UTSW	11	98158404	missense	probably damaging	1.00
R0698:Med1	UTSW	11	98155689	intron	probably benign
R1293:Med1	UTSW	11	98157036	missense	possibly damaging	0.93
R1302:Med1	UTSW	11	98157449	missense	possibly damaging	0.50
R1365:Med1	UTSW	11	98155995	intron	probably benign
R1537:Med1	UTSW	11	98160946	missense	probably damaging	0.97
R1609:Med1	UTSW	11	98161170	missense	possibly damaging	0.91
R1631:Med1	UTSW	11	98155626	intron	probably benign
R1792:Med1	UTSW	11	98157283	missense	probably damaging	1.00
R1831:Med1	UTSW	11	98156611	intron	probably benign
R1837:Med1	UTSW	11	98169412	missense	probably damaging	1.00
R2366:Med1	UTSW	11	98161182	missense	probably damaging	0.98
R3754:Med1	UTSW	11	98166722	missense	possibly damaging	0.77
R3762:Med1	UTSW	11	98155515	intron	probably benign
R4012:Med1	UTSW	11	98171706	missense	possibly damaging	0.85
R4112:Med1	UTSW	11	98180087	missense	probably damaging	1.00
R4579:Med1	UTSW	11	98158422	missense	possibly damaging	0.56
R4740:Med1	UTSW	11	98180264	nonsense	probably null
R4819:Med1	UTSW	11	98155432	intron	probably benign
R4879:Med1	UTSW	11	98155360	unclassified	probably benign
R4993:Med1	UTSW	11	98163904	missense	probably damaging	1.00
R5040:Med1	UTSW	11	98155404	intron	probably benign
R5249:Med1	UTSW	11	98157240	missense	probably benign	0.43
R5373:Med1	UTSW	11	98163963	missense	probably damaging	0.99
R5374:Med1	UTSW	11	98163963	missense	probably damaging	0.99
R5552:Med1	UTSW	11	98166331	nonsense	probably null
R5692:Med1	UTSW	11	98156380	intron	probably benign
R6010:Med1	UTSW	11	98158362	missense	probably damaging	1.00
R6149:Med1	UTSW	11	98183853	missense	possibly damaging	0.74
R6417:Med1	UTSW	11	98157228	missense	probably damaging	0.97
R7301:Med1	UTSW	11	98152808	missense	probably benign	0.23
R7507:Med1	UTSW	11	98158026	missense	probably damaging	1.00
R7529:Med1	UTSW	11	98155965	missense	unknown
R7588:Med1	UTSW	11	98155572	missense	unknown
R7654:Med1	UTSW	11	98169363	missense	possibly damaging	0.75
R7662:Med1	UTSW	11	98155392	missense	unknown
R7679:Med1	UTSW	11	98156061	missense	unknown
R7862:Med1	UTSW	11	98161210	missense	probably benign	0.05
R8447:Med1	UTSW	11	98169414	missense	probably damaging	1.00
Z1176:Med1	UTSW	11	98161183	missense	possibly damaging	0.62

Predicted Primers

PCR Primer
(F):5'- TGCTCACCTCGAAAACACTTG -3'
(R):5'- TAAGCCCCTGAATTGCTGATGG -3'

Sequencing Primer
(F):5'- CATCAGAGCAGATTTTTGTCC -3'
(R):5'- TCTGAACTTGCTTAACAGGGAGCC -3'

Posted On

2015-07-06