Incidental Mutation 'R4384:Mylip'
ID326127
Institutional Source Beutler Lab
Gene Symbol Mylip
Ensembl Gene ENSMUSG00000038175
Gene Namemyosin regulatory light chain interacting protein
SynonymsMir, 9430057C20Rik, Idol
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4384 (G1)
Quality Score135
Status Validated
Chromosome13
Chromosomal Location45389742-45412022 bp(+) (GRCm38)
Type of Mutationstart codon destroyed
DNA Base Change (assembly) T to C at 45389958 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 1 (M1T)
Ref Sequence ENSEMBL: ENSMUSP00000047403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038275] [ENSMUST00000222178]
Predicted Effect probably null
Transcript: ENSMUST00000038275
AA Change: M1T

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000047403
Gene: ENSMUSG00000038175
AA Change: M1T

DomainStartEndE-ValueType
B41 1 190 2.85e-36 SMART
FERM_C 194 283 1.87e-16 SMART
low complexity region 342 368 N/A INTRINSIC
RING 387 421 2.92e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000222178
Meta Mutation Damage Score 0.9289 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The ERM protein family members ezrin, radixin, and moesin are cytoskeletal effector proteins linking actin to membrane-bound proteins at the cell surface. Myosin regulatory light chain interacting protein (MYLIP) is a novel ERM-like protein that interacts with myosin regulatory light chain and inhibits neurite outgrowth. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Mylip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00429:Mylip APN 13 45408567 missense probably benign 0.03
IGL01603:Mylip APN 13 45390003 missense probably benign 0.13
IGL01919:Mylip APN 13 45408702 missense probably damaging 1.00
IGL02341:Mylip APN 13 45391276 missense probably damaging 0.99
IGL02657:Mylip APN 13 45391246 missense probably benign
IGL03239:Mylip APN 13 45406625 missense possibly damaging 0.89
PIT4283001:Mylip UTSW 13 45406634 missense possibly damaging 0.46
R0482:Mylip UTSW 13 45404583 missense probably benign 0.11
R1217:Mylip UTSW 13 45406702 missense probably damaging 1.00
R1318:Mylip UTSW 13 45405925 missense probably benign
R1341:Mylip UTSW 13 45405936 missense probably damaging 0.98
R1531:Mylip UTSW 13 45406570 missense possibly damaging 0.94
R1749:Mylip UTSW 13 45404470 missense possibly damaging 0.46
R1942:Mylip UTSW 13 45406696 missense probably damaging 1.00
R4922:Mylip UTSW 13 45408762 missense probably damaging 1.00
R5895:Mylip UTSW 13 45408702 nonsense probably null
R6247:Mylip UTSW 13 45408481 missense probably damaging 1.00
R8003:Mylip UTSW 13 45404471 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TAAAAGACGCGTGCCTGTAGC -3'
(R):5'- ACCGTAAGCGTCCTCTATGC -3'

Sequencing Primer
(F):5'- TGTAGCTCCCGGGAACTG -3'
(R):5'- GCACTCTCCACTCGCGG -3'
Posted On2015-07-06