Incidental Mutation 'R4384:Sema4d'
ID326128
Institutional Source Beutler Lab
Gene Symbol Sema4d
Ensembl Gene ENSMUSG00000021451
Gene Namesema domain, immunoglobulin domain (Ig), transmembrane domain (TM) and short cytoplasmic domain, (semaphorin) 4D
SynonymsSemacl2, coll-4, Semcl2, semaphorin H, CD100, Semaj, M-sema G
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location51685529-51793747 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 51702883 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 771 (L771P)
Ref Sequence ENSEMBL: ENSMUSP00000105667 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021900] [ENSMUST00000110039] [ENSMUST00000110040] [ENSMUST00000110042]
Predicted Effect probably damaging
Transcript: ENSMUST00000021900
AA Change: L771P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000021900
Gene: ENSMUSG00000021451
AA Change: L771P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 482 7.68e-192 SMART
PSI 502 554 1.41e-12 SMART
IG 561 647 4.78e-1 SMART
transmembrane domain 733 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110039
AA Change: L771P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105666
Gene: ENSMUSG00000021451
AA Change: L771P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 482 7.68e-192 SMART
PSI 502 554 1.41e-12 SMART
IG 561 647 4.78e-1 SMART
transmembrane domain 733 755 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110040
AA Change: L771P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105667
Gene: ENSMUSG00000021451
AA Change: L771P

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Sema 50 482 7.68e-192 SMART
PSI 502 554 1.41e-12 SMART
IG 561 647 4.78e-1 SMART
transmembrane domain 733 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110042
SMART Domains Protein: ENSMUSP00000105669
Gene: ENSMUSG00000021451

DomainStartEndE-ValueType
Blast:IG 2 46 2e-15 BLAST
Meta Mutation Damage Score 0.4127 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype PHENOTYPE: Mice homozygous for disruptions in this gene display functional defects in their immune system but are normal in other systems of the body. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Sema4d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02131:Sema4d APN 13 51702937 intron probably null
IGL02155:Sema4d APN 13 51703267 missense probably benign 0.01
IGL02422:Sema4d APN 13 51703088 missense probably benign
IGL02795:Sema4d APN 13 51703411 missense probably benign 0.00
IGL03068:Sema4d APN 13 51708886 missense probably damaging 1.00
IGL03164:Sema4d APN 13 51708922 missense possibly damaging 0.58
R0060:Sema4d UTSW 13 51705257 unclassified probably benign
R0060:Sema4d UTSW 13 51705257 unclassified probably benign
R0305:Sema4d UTSW 13 51712728 missense probably damaging 1.00
R0309:Sema4d UTSW 13 51725311 missense probably benign 0.14
R0708:Sema4d UTSW 13 51712719 missense probably benign 0.17
R1809:Sema4d UTSW 13 51713691 critical splice donor site probably null
R1851:Sema4d UTSW 13 51711222 missense possibly damaging 0.94
R2096:Sema4d UTSW 13 51710001 missense probably damaging 1.00
R2159:Sema4d UTSW 13 51720535 missense probably damaging 1.00
R2367:Sema4d UTSW 13 51703140 intron probably benign
R4329:Sema4d UTSW 13 51703304 missense probably benign
R4372:Sema4d UTSW 13 51712731 missense probably damaging 1.00
R4590:Sema4d UTSW 13 51723618 missense probably benign 0.29
R4980:Sema4d UTSW 13 51711234 missense probably damaging 1.00
R5523:Sema4d UTSW 13 51711354 missense possibly damaging 0.89
R6086:Sema4d UTSW 13 51713745 missense probably damaging 1.00
R7197:Sema4d UTSW 13 51702836 missense probably benign 0.01
R7340:Sema4d UTSW 13 51723562 missense probably damaging 1.00
R7606:Sema4d UTSW 13 51723622 missense probably benign 0.00
R7859:Sema4d UTSW 13 51722351 missense probably benign 0.30
R7942:Sema4d UTSW 13 51722351 missense probably benign 0.30
R7977:Sema4d UTSW 13 51710006 missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- TTGACATCAAACGGTTTGTCC -3'
(R):5'- ATGGTCATCAACACGGTCCC -3'

Sequencing Primer
(F):5'- CAGAGAGTTCATCGATCCGTTGC -3'
(R):5'- GTCCCCCAGCTCCACTCAG -3'
Posted On2015-07-06