Mutagenetix > Incidental Mutation

Incidental Mutation 'R4384:Cntnap3'

326129

Institutional Source

Beutler Lab

Gene Symbol

Cntnap3

Ensembl Gene

ENSMUSG00000033063

Gene Name

contactin associated protein-like 3

Synonyms

MMRRC Submission

042002-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.055) question?

Stock #

R4384 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

64736182-64903955 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 64748460 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Histidine at position 1067 (Y1067H)

Ref Sequence

ENSEMBL: ENSMUSP00000089140 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000091554]

AlphaFold

E9PY62

Predicted Effect

probably damaging
Transcript: ENSMUST00000091554
AA Change: Y1067H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000089140
Gene: ENSMUSG00000033063
AA Change: Y1067H

Domain	Start	End	E-Value	Type
signal peptide	1	28	N/A	INTRINSIC
FA58C	33	180	4.88e-17	SMART
LamG	207	345	1.47e-11	SMART
LamG	394	525	1.43e-23	SMART
EGF	553	587	1.33e-1	SMART
FBG	590	775	6.76e-1	SMART
LamG	815	942	1.89e-32	SMART
EGF_like	963	999	6.28e1	SMART
LamG	1040	1178	9.46e-15	SMART
transmembrane domain	1245	1267	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000222618

Meta Mutation Damage Score

0.1863

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 97.0%
20x: 94.4%

Validation Efficiency

97% (56/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the NCP family of cell-recognition molecules. This family represents a distinct subgroup of the neurexins. NCP proteins mediate neuron-glial interactions in vertebrates and glial-glial contact in invertebrates. The protein encoded by this gene may play a role in cell recognition within the nervous system. Alternatively spliced transcript variants encoding different isoforms have been described but their biological nature has not been determined. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 51 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acer2	T	A	4: 86,874,568	V27E	possibly damaging	Het
Adam23	T	C	1: 63,566,628	Y624H	probably damaging	Het
Arhgef10	T	A	8: 14,930,157	C132*	probably null	Het
Boc	A	T	16: 44,491,182	L726H	probably damaging	Het
Brip1	A	T	11: 86,148,429	D426E	possibly damaging	Het
Cadps2	T	A	6: 23,412,988	Q654L	probably benign	Het
Calr3	T	A	8: 72,428,164	D120V	probably damaging	Het
Csnk1g1	T	C	9: 66,019,908	V119A	probably damaging	Het
Ddias	G	A	7: 92,858,223	T828I	probably damaging	Het
Dennd4c	A	G	4: 86,811,450	Y763C	probably damaging	Het
Dscam	T	A	16: 96,709,216	I948F	probably damaging	Het
E030018B13Rik	A	G	7: 63,919,393		probably benign	Het
E2f8	G	A	7: 48,867,099	T844I	possibly damaging	Het
Eps8	T	A	6: 137,499,592	H603L	probably benign	Het
Esrrg	G	A	1: 188,043,711	C122Y	probably damaging	Het
Frmd4a	C	T	2: 4,594,563	R467*	probably null	Het
Gad2	G	A	2: 22,685,410	V509I	probably benign	Het
Gpat4	A	G	8: 23,174,586	I446T	probably benign	Het
Klhl12	T	G	1: 134,487,654	D435E	probably damaging	Het
Luc7l	T	C	17: 26,279,962		probably benign	Het
March2	C	A	17: 33,696,193	M142I	probably benign	Het
Marf1	T	A	16: 14,142,641	Y513F	possibly damaging	Het
Mdm2	T	C	10: 117,696,439	D114G	possibly damaging	Het
Med1	G	A	11: 98,152,862		probably benign	Het
Meikin	C	T	11: 54,417,787	Q404*	probably null	Het
Myh9	A	T	15: 77,791,712		probably benign	Het
Mylip	T	C	13: 45,389,958	M1T	probably null	Het
Ncapg2	T	C	12: 116,439,877		probably null	Het
Nmd3	T	C	3: 69,724,398		probably benign	Het
Nwd2	T	A	5: 63,806,571	L1166H	probably damaging	Het
Olfr341	A	G	2: 36,479,998	L44P	probably damaging	Het
Olfr912	T	C	9: 38,582,053	Y259H	probably damaging	Het
Rubcn	A	G	16: 32,856,902	I71T	probably damaging	Het
Rwdd3	T	C	3: 121,158,757		probably benign	Het
Ryr2	T	C	13: 11,605,233	E3826G	probably damaging	Het
Sdad1	T	C	5: 92,298,257	Q273R	probably benign	Het
Sdha	A	T	13: 74,326,985	I579K	possibly damaging	Het
Sema4d	A	G	13: 51,702,883	L771P	probably damaging	Het
Shroom3	G	T	5: 92,943,086	V1151F	probably damaging	Het
Slc6a11	A	G	6: 114,247,727	E624G	possibly damaging	Het
Tada3	G	T	6: 113,370,379	R117S	probably damaging	Het
Tm9sf3	T	C	19: 41,247,933	M130V	probably damaging	Het
Trpc1	C	A	9: 95,732,108	M34I	probably benign	Het
Trpc4ap	A	G	2: 155,640,507	V521A	possibly damaging	Het
Trpm2	A	G	10: 77,917,725	V1315A	probably benign	Het
Tvp23a	A	G	16: 10,428,682	S80P	probably benign	Het
Usp54	A	T	14: 20,550,085		probably null	Het
Vmn2r27	A	G	6: 124,224,156	Y281H	probably benign	Het
Vwf	T	A	6: 125,655,116	I37N	unknown	Het
Zfp329	G	A	7: 12,811,657		probably benign	Het
Zfp616	G	T	11: 74,083,179	L91F	possibly damaging	Het

Other mutations in Cntnap3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00433:Cntnap3	APN	13	64772731	missense	probably damaging	1.00
IGL00782:Cntnap3	APN	13	64745805	splice site	probably benign
IGL00976:Cntnap3	APN	13	64794352	missense	probably damaging	1.00
IGL01319:Cntnap3	APN	13	64787837	missense	probably damaging	1.00
IGL01610:Cntnap3	APN	13	64757301	missense	probably damaging	0.98
IGL01861:Cntnap3	APN	13	64799108	missense	probably damaging	1.00
IGL02127:Cntnap3	APN	13	64799064	splice site	probably benign
IGL02133:Cntnap3	APN	13	64751673	splice site	probably benign
IGL02251:Cntnap3	APN	13	64762036	missense	probably damaging	1.00
IGL02272:Cntnap3	APN	13	64757411	missense	probably damaging	1.00
IGL02370:Cntnap3	APN	13	64751751	missense	probably benign
IGL02456:Cntnap3	APN	13	64799058	splice site	probably benign
IGL02589:Cntnap3	APN	13	64792430	missense	probably benign	0.08
IGL02695:Cntnap3	APN	13	64772132	missense	probably benign	0.01
IGL02850:Cntnap3	APN	13	64757409	missense	probably damaging	1.00
IGL03038:Cntnap3	APN	13	64741025	missense	possibly damaging	0.50
IGL03188:Cntnap3	APN	13	64781745	missense	probably damaging	0.97
IGL03327:Cntnap3	APN	13	64887768	nonsense	probably null
PIT4480001:Cntnap3	UTSW	13	64757210	missense	probably damaging	1.00
R0309:Cntnap3	UTSW	13	64757436	splice site	probably benign
R0422:Cntnap3	UTSW	13	64757285	missense	probably damaging	0.96
R0463:Cntnap3	UTSW	13	64778876	missense	probably damaging	1.00
R0491:Cntnap3	UTSW	13	64762045	missense	probably benign	0.01
R0499:Cntnap3	UTSW	13	64858678	missense	probably benign	0.33
R0550:Cntnap3	UTSW	13	64762000	missense	possibly damaging	0.86
R0613:Cntnap3	UTSW	13	64758414	missense	probably damaging	1.00
R0666:Cntnap3	UTSW	13	64757397	missense	probably damaging	1.00
R0840:Cntnap3	UTSW	13	64787910	missense	possibly damaging	0.94
R1577:Cntnap3	UTSW	13	64758290	missense	probably damaging	1.00
R1716:Cntnap3	UTSW	13	64762002	missense	probably damaging	1.00
R1732:Cntnap3	UTSW	13	64740812	critical splice donor site	probably null
R1739:Cntnap3	UTSW	13	64740592	missense	probably benign	0.17
R1905:Cntnap3	UTSW	13	64903764	missense	probably benign	0.04
R1988:Cntnap3	UTSW	13	64758390	missense	probably damaging	1.00
R2086:Cntnap3	UTSW	13	64794262	missense	possibly damaging	0.76
R3732:Cntnap3	UTSW	13	64740999	missense	possibly damaging	0.73
R3808:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R3809:Cntnap3	UTSW	13	64781804	missense	probably damaging	0.96
R4433:Cntnap3	UTSW	13	64778853	missense	possibly damaging	0.92
R4631:Cntnap3	UTSW	13	64778883	missense	probably benign	0.04
R4645:Cntnap3	UTSW	13	64778788	critical splice donor site	probably null
R4702:Cntnap3	UTSW	13	64778862	missense	probably benign	0.17
R4876:Cntnap3	UTSW	13	64787706	missense	probably benign	0.00
R4994:Cntnap3	UTSW	13	64761984	missense	possibly damaging	0.55
R5043:Cntnap3	UTSW	13	64794348	missense	probably damaging	1.00
R5214:Cntnap3	UTSW	13	64762010	missense	probably damaging	1.00
R5403:Cntnap3	UTSW	13	64761978	missense	possibly damaging	0.90
R5571:Cntnap3	UTSW	13	64903758	missense	probably damaging	0.98
R5587:Cntnap3	UTSW	13	64746738	missense	probably damaging	1.00
R5695:Cntnap3	UTSW	13	64787955	missense	probably damaging	0.99
R5834:Cntnap3	UTSW	13	64748577	missense	probably benign	0.07
R5892:Cntnap3	UTSW	13	64799180	missense	probably damaging	1.00
R5950:Cntnap3	UTSW	13	64787769	missense	probably damaging	1.00
R6526:Cntnap3	UTSW	13	64781888	missense	possibly damaging	0.96
R6954:Cntnap3	UTSW	13	64748559	missense	probably benign	0.00
R7138:Cntnap3	UTSW	13	64781725	critical splice donor site	probably null
R7355:Cntnap3	UTSW	13	64771962	missense	probably benign
R7425:Cntnap3	UTSW	13	64758252	missense	probably damaging	1.00
R7521:Cntnap3	UTSW	13	64772001	missense	probably benign	0.22
R7719:Cntnap3	UTSW	13	64772777	nonsense	probably null
R7810:Cntnap3	UTSW	13	64793308	missense	possibly damaging	0.73
R7871:Cntnap3	UTSW	13	64903773	missense	probably benign	0.00
R8259:Cntnap3	UTSW	13	64787867	missense	probably damaging	0.99
R8415:Cntnap3	UTSW	13	64738665	missense	probably benign	0.31
R8491:Cntnap3	UTSW	13	64785343	missense	probably damaging	1.00
R9086:Cntnap3	UTSW	13	64781759	missense	probably damaging	1.00
R9087:Cntnap3	UTSW	13	64751718	missense	probably damaging	0.96
R9398:Cntnap3	UTSW	13	64903834	missense	probably benign	0.41
R9475:Cntnap3	UTSW	13	64799135	missense	probably damaging	1.00
R9625:Cntnap3	UTSW	13	64858765	missense	probably damaging	1.00
R9679:Cntnap3	UTSW	13	64751748	missense	probably damaging	1.00
Z1176:Cntnap3	UTSW	13	64740872	frame shift	probably null
Z1176:Cntnap3	UTSW	13	64792388	missense	probably damaging	0.98
Z1177:Cntnap3	UTSW	13	64781892	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- AGTAACACTAGCTTCTATGACATCCAC -3'
(R):5'- TGAAACGGGTTCCTCAGTGAC -3'

Sequencing Primer
(F):5'- ACTGTGGATAGCCCTGAAATAC -3'
(R):5'- GGGTTCCTCAGTGACCTATAATTTTC -3'

Posted On

2015-07-06