Incidental Mutation 'R4384:Usp54'
ID326131
Institutional Source Beutler Lab
Gene Symbol Usp54
Ensembl Gene ENSMUSG00000034235
Gene Nameubiquitin specific peptidase 54
SynonymsC030002J06Rik, 4930429G18Rik
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location20548912-20641063 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to T at 20550085 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000125582 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022355] [ENSMUST00000022356] [ENSMUST00000035340] [ENSMUST00000159027] [ENSMUST00000161445] [ENSMUST00000161989]
Predicted Effect probably null
Transcript: ENSMUST00000022355
SMART Domains Protein: ENSMUSP00000022355
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000022356
AA Change: L1528Q

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000022356
Gene: ENSMUSG00000034235
AA Change: L1528Q

DomainStartEndE-ValueType
Pfam:UCH 30 349 2.4e-23 PFAM
Pfam:UCH_1 31 324 2.1e-7 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000035340
AA Change: L1528Q

PolyPhen 2 Score 0.060 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000036214
Gene: ENSMUSG00000034235
AA Change: L1528Q

DomainStartEndE-ValueType
Pfam:UCH 31 349 2.3e-21 PFAM
low complexity region 403 412 N/A INTRINSIC
low complexity region 439 445 N/A INTRINSIC
low complexity region 498 513 N/A INTRINSIC
low complexity region 601 616 N/A INTRINSIC
coiled coil region 682 712 N/A INTRINSIC
low complexity region 808 826 N/A INTRINSIC
low complexity region 881 894 N/A INTRINSIC
low complexity region 1002 1020 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128848
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141265
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142099
Predicted Effect probably null
Transcript: ENSMUST00000159027
SMART Domains Protein: ENSMUSP00000125722
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161445
SMART Domains Protein: ENSMUSP00000125630
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
Predicted Effect probably null
Transcript: ENSMUST00000161989
SMART Domains Protein: ENSMUSP00000125582
Gene: ENSMUSG00000021816

DomainStartEndE-ValueType
low complexity region 2 20 N/A INTRINSIC
PP2Ac 65 356 5.03e-166 SMART
low complexity region 487 497 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Usp54
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00585:Usp54 APN 14 20573837 missense probably damaging 1.00
IGL01090:Usp54 APN 14 20586157 unclassified probably benign
IGL02030:Usp54 APN 14 20565946 missense probably benign 0.44
IGL02333:Usp54 APN 14 20589395 missense probably damaging 1.00
IGL02642:Usp54 APN 14 20565072 splice site probably benign
IGL02970:Usp54 APN 14 20577472 missense probably damaging 1.00
IGL03371:Usp54 APN 14 20589368 unclassified probably benign
R0050:Usp54 UTSW 14 20573755 unclassified probably benign
R0383:Usp54 UTSW 14 20561252 missense probably benign 0.00
R0427:Usp54 UTSW 14 20570364 missense probably benign
R0442:Usp54 UTSW 14 20607209 missense probably damaging 1.00
R0574:Usp54 UTSW 14 20556254 missense probably benign 0.00
R0638:Usp54 UTSW 14 20589369 unclassified probably benign
R0789:Usp54 UTSW 14 20562157 missense probably benign 0.01
R1272:Usp54 UTSW 14 20561110 missense probably damaging 0.99
R1463:Usp54 UTSW 14 20550190 missense probably benign 0.15
R1565:Usp54 UTSW 14 20607159 missense probably damaging 1.00
R1721:Usp54 UTSW 14 20583440 nonsense probably null
R1922:Usp54 UTSW 14 20560904 missense probably benign 0.00
R2068:Usp54 UTSW 14 20577205 missense probably damaging 1.00
R2216:Usp54 UTSW 14 20561840 missense probably benign
R2285:Usp54 UTSW 14 20561178 missense possibly damaging 0.52
R2426:Usp54 UTSW 14 20564940 missense probably benign 0.00
R3855:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3856:Usp54 UTSW 14 20588420 missense probably damaging 1.00
R3907:Usp54 UTSW 14 20586113 missense probably damaging 1.00
R4367:Usp54 UTSW 14 20561134 missense probably benign 0.02
R4555:Usp54 UTSW 14 20561022 missense probably benign 0.06
R4617:Usp54 UTSW 14 20550338 missense probably benign 0.04
R4659:Usp54 UTSW 14 20564992 missense probably damaging 1.00
R4672:Usp54 UTSW 14 20581529 intron probably benign
R4928:Usp54 UTSW 14 20562192 missense probably damaging 1.00
R5381:Usp54 UTSW 14 20586076 missense probably damaging 1.00
R5408:Usp54 UTSW 14 20550433 missense probably damaging 1.00
R5630:Usp54 UTSW 14 20565057 missense probably damaging 1.00
R5841:Usp54 UTSW 14 20550283 missense probably benign 0.04
R5886:Usp54 UTSW 14 20561842 missense probably benign 0.28
R5922:Usp54 UTSW 14 20552071 splice site probably null
R5975:Usp54 UTSW 14 20583351 missense possibly damaging 0.77
R6074:Usp54 UTSW 14 20552099 missense probably benign 0.02
R6183:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R6234:Usp54 UTSW 14 20583450 missense probably damaging 1.00
R6303:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6304:Usp54 UTSW 14 20560968 missense possibly damaging 0.95
R6695:Usp54 UTSW 14 20560869 missense possibly damaging 0.94
R6774:Usp54 UTSW 14 20577228 missense probably damaging 1.00
R6941:Usp54 UTSW 14 20562109 missense probably benign
R7133:Usp54 UTSW 14 20561242 missense probably benign 0.00
R7196:Usp54 UTSW 14 20588370 missense probably damaging 1.00
R7409:Usp54 UTSW 14 20552245 missense probably damaging 0.99
R7424:Usp54 UTSW 14 20577040 missense probably benign 0.15
X0024:Usp54 UTSW 14 20577251 small deletion probably benign
Predicted Primers PCR Primer
(F):5'- GGATGAAGGTGTAGCTCCAG -3'
(R):5'- TATGCCAGCATGCAAGCCTC -3'

Sequencing Primer
(F):5'- TACCACCTGCTGTGCTGTAGAAATC -3'
(R):5'- GCCTCAGCTAACCTACACTG -3'
Posted On2015-07-06