Incidental Mutation 'R4384:Tvp23a'
ID326133
Institutional Source Beutler Lab
Gene Symbol Tvp23a
Ensembl Gene ENSMUSG00000050908
Gene Nametrans-golgi network vesicle protein 23A
Synonyms
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location10420557-10447362 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 10428682 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 80 (S80P)
Ref Sequence ENSEMBL: ENSMUSP00000052922 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023146] [ENSMUST00000051118] [ENSMUST00000128288]
Predicted Effect probably benign
Transcript: ENSMUST00000023146
SMART Domains Protein: ENSMUSP00000023146
Gene: ENSMUSG00000022503

DomainStartEndE-ValueType
AAA 54 210 6.23e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000051118
AA Change: S80P

PolyPhen 2 Score 0.065 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000052922
Gene: ENSMUSG00000050908
AA Change: S80P

DomainStartEndE-ValueType
Pfam:DUF846 39 180 1.6e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000128288
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135315
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141587
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142771
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153027
Meta Mutation Damage Score 0.8390 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a membrane protein associated with the Golgi apparatus, which plays a crucial role in intracellular vesicular transport. The encoded protein is likely associated with the late (trans) Golgi compartments, which are involved in the delivery of secretory and membrane proteins to the endosome, lysosome or the plasma membrane. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Tvp23a
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1556:Tvp23a UTSW 16 10446998 missense probably damaging 1.00
R1691:Tvp23a UTSW 16 10428687 missense possibly damaging 0.59
R4633:Tvp23a UTSW 16 10427045 missense probably benign 0.04
R4721:Tvp23a UTSW 16 10427411 missense probably benign 0.16
R6843:Tvp23a UTSW 16 10447020 missense probably benign
R7076:Tvp23a UTSW 16 10428735 missense probably benign 0.22
R7619:Tvp23a UTSW 16 10428738 missense probably damaging 1.00
R7774:Tvp23a UTSW 16 10427381 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- AGTGTTCACGTGCCATAGC -3'
(R):5'- TGAGTTCCAGGTTCTCCCTAGG -3'

Sequencing Primer
(F):5'- TCCTTACACAGAGTGGATTCCAAGG -3'
(R):5'- AGGTACCCCCTGTTCTTGGG -3'
Posted On2015-07-06