Incidental Mutation 'R4384:Boc'
ID326136
Institutional Source Beutler Lab
Gene Symbol Boc
Ensembl Gene ENSMUSG00000022687
Gene Namebiregional cell adhesion molecule-related/down-regulated by oncogenes (Cdon) binding protein
Synonyms
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location44485049-44558897 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 44491182 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 726 (L726H)
Ref Sequence ENSEMBL: ENSMUSP00000110281 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114634]
Predicted Effect probably damaging
Transcript: ENSMUST00000023370
AA Change: L726H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023370
Gene: ENSMUSG00000022687
AA Change: L726H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000114634
AA Change: L726H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110281
Gene: ENSMUSG00000022687
AA Change: L726H

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
IGc2 43 108 4.36e-4 SMART
IG 130 217 8.99e-6 SMART
IGc2 238 301 3.94e-11 SMART
IGc2 330 393 1.46e-14 SMART
low complexity region 423 433 N/A INTRINSIC
FN3 467 553 1.14e-5 SMART
FN3 601 685 3.53e-11 SMART
FN3 707 794 4.25e-5 SMART
low complexity region 813 829 N/A INTRINSIC
transmembrane domain 851 873 N/A INTRINSIC
Meta Mutation Damage Score 0.7304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the immunoglobulin/fibronectin type III repeat family. It is a component of a cell-surface receptor complex that mediates cell-cell interactions between muscle precursor cells, and promotes myogenic differentiation. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2014]
PHENOTYPE: Mice homozygous for a null mutation display abnormal commissural axon projections. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Boc
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:Boc APN 16 44492955 missense probably benign 0.00
IGL00981:Boc APN 16 44491801 missense probably damaging 0.99
IGL01820:Boc APN 16 44491872 missense possibly damaging 0.88
IGL03114:Boc APN 16 44486752 missense probably benign 0.38
IGL03195:Boc APN 16 44492821 missense probably damaging 0.99
R0006:Boc UTSW 16 44496449 missense probably benign 0.41
R0142:Boc UTSW 16 44490241 missense probably damaging 1.00
R0417:Boc UTSW 16 44520234 missense probably benign 0.16
R1066:Boc UTSW 16 44490684 critical splice acceptor site probably null
R1248:Boc UTSW 16 44520473 missense probably benign 0.03
R1438:Boc UTSW 16 44488746 splice site probably null
R1506:Boc UTSW 16 44503565 missense probably damaging 1.00
R1729:Boc UTSW 16 44496419 missense probably benign 0.00
R1784:Boc UTSW 16 44496419 missense probably benign 0.00
R2004:Boc UTSW 16 44501644 critical splice donor site probably null
R2441:Boc UTSW 16 44488623 missense probably damaging 1.00
R2863:Boc UTSW 16 44492960 missense probably benign 0.03
R3885:Boc UTSW 16 44487613 splice site probably benign
R4201:Boc UTSW 16 44490618 missense probably damaging 1.00
R4239:Boc UTSW 16 44491884 missense probably damaging 1.00
R4382:Boc UTSW 16 44491182 missense probably damaging 1.00
R4385:Boc UTSW 16 44491182 missense probably damaging 1.00
R4684:Boc UTSW 16 44500380 missense probably benign 0.07
R4776:Boc UTSW 16 44487721 missense probably damaging 0.99
R4788:Boc UTSW 16 44500433 missense probably damaging 1.00
R4830:Boc UTSW 16 44490157 missense probably damaging 1.00
R5000:Boc UTSW 16 44490154 missense probably damaging 1.00
R5567:Boc UTSW 16 44492824 missense probably damaging 1.00
R5570:Boc UTSW 16 44492824 missense probably damaging 1.00
R5645:Boc UTSW 16 44499661 missense probably damaging 0.99
R5651:Boc UTSW 16 44521195 missense probably benign 0.00
R5881:Boc UTSW 16 44490651 missense probably damaging 1.00
R6021:Boc UTSW 16 44488654 missense probably benign 0.00
R6085:Boc UTSW 16 44488607 missense probably damaging 1.00
R6188:Boc UTSW 16 44499548 missense possibly damaging 0.67
R6295:Boc UTSW 16 44492348 missense probably benign 0.05
R6366:Boc UTSW 16 44487652 missense probably benign 0.04
R6626:Boc UTSW 16 44520440 missense possibly damaging 0.47
R6629:Boc UTSW 16 44492361 missense probably benign 0.11
R6707:Boc UTSW 16 44500616 missense possibly damaging 0.71
R6819:Boc UTSW 16 44492825 missense probably damaging 0.99
R6904:Boc UTSW 16 44491791 missense probably damaging 1.00
R7260:Boc UTSW 16 44490170 missense
R7353:Boc UTSW 16 44485737 missense unknown
R7458:Boc UTSW 16 44486756 missense
Predicted Primers PCR Primer
(F):5'- AAGGCTTGAGATTCCCTGTGG -3'
(R):5'- TCAGGAAGACTCTCCCTTACAG -3'

Sequencing Primer
(F):5'- TCCCTGTGGTATCGGGTAAAAAGC -3'
(R):5'- GGAAGACTCTCCCTTACAGGTATTTC -3'
Posted On2015-07-06