Incidental Mutation 'R4384:March2'
ID326138
Institutional Source Beutler Lab
Gene Symbol March2
Ensembl Gene ENSMUSG00000079557
Gene Namemembrane-associated ring finger (C3HC4) 2
Synonyms
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location33685692-33718670 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33696193 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Isoleucine at position 142 (M142I)
Ref Sequence ENSEMBL: ENSMUSP00000133802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066121] [ENSMUST00000167611] [ENSMUST00000172767] [ENSMUST00000172934] [ENSMUST00000173015] [ENSMUST00000173329] [ENSMUST00000173454] [ENSMUST00000174040] [ENSMUST00000186022]
Predicted Effect probably benign
Transcript: ENSMUST00000066121
AA Change: M142I

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000065225
Gene: ENSMUSG00000079557
AA Change: M142I

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 143 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167611
AA Change: M142I

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127601
Gene: ENSMUSG00000079557
AA Change: M142I

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 143 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172767
AA Change: M142I

PolyPhen 2 Score 0.032 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000134220
Gene: ENSMUSG00000079557
AA Change: M142I

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 143 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000172934
AA Change: M142I

PolyPhen 2 Score 0.017 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134026
Gene: ENSMUSG00000079557
AA Change: M142I

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 142 161 N/A INTRINSIC
transmembrane domain 176 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173015
AA Change: M142I

PolyPhen 2 Score 0.338 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133802
Gene: ENSMUSG00000079557
AA Change: M142I

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 179 201 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173329
AA Change: M142I

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000133825
Gene: ENSMUSG00000079557
AA Change: M142I

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 142 164 N/A INTRINSIC
transmembrane domain 174 196 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173454
AA Change: M81I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000133940
Gene: ENSMUSG00000079557
AA Change: M81I

DomainStartEndE-ValueType
RINGv 2 49 2.86e-23 SMART
transmembrane domain 82 99 N/A INTRINSIC
transmembrane domain 114 136 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174040
AA Change: M162I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000134437
Gene: ENSMUSG00000079557
AA Change: M162I

DomainStartEndE-ValueType
RINGv 83 130 2.86e-23 SMART
transmembrane domain 158 180 N/A INTRINSIC
transmembrane domain 193 215 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000186022
AA Change: M142I

PolyPhen 2 Score 0.039 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000139724
Gene: ENSMUSG00000079557
AA Change: M142I

DomainStartEndE-ValueType
RINGv 63 110 2.86e-23 SMART
transmembrane domain 143 160 N/A INTRINSIC
transmembrane domain 175 197 N/A INTRINSIC
Meta Mutation Damage Score 0.1211 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] MARCH2 is a member of the MARCH family of membrane-bound E3 ubiquitin ligases (EC 6.3.2.19). MARCH enzymes add ubiquitin (see MIM 191339) to target lysines in substrate proteins, thereby signaling their vesicular transport between membrane compartments. MARCH2 reduces surface accumulation of several glycoproteins and appears to regulate early endosome-to-trans-Golgi network (TGN) trafficking (Bartee et al., 2004 [PubMed 14722266]; Nakamura et al., 2005 [PubMed 15689499]).[supplied by OMIM, Mar 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gad2 G A 2: 22,685,410 V509I probably benign Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in March2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01668:March2 APN 17 33703096 missense probably damaging 1.00
IGL02562:March2 APN 17 33696074 missense probably damaging 1.00
R1022:March2 UTSW 17 33709788 missense probably damaging 1.00
R1024:March2 UTSW 17 33709788 missense probably damaging 1.00
R1398:March2 UTSW 17 33696122 missense probably damaging 1.00
R4760:March2 UTSW 17 33709916 missense probably damaging 1.00
R4776:March2 UTSW 17 33709916 missense probably damaging 1.00
R7541:March2 UTSW 17 33703058 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCCCTGGACCTGTGTTACAATG -3'
(R):5'- GCACTCAGCAGACTCCTTTC -3'

Sequencing Primer
(F):5'- GACCTGTGTTACAATGTCAACCTGG -3'
(R):5'- CTCAGCAGACTCCTTTCATTAATAG -3'
Posted On2015-07-06