Mutagenetix > Incidental Mutation

Incidental Mutation 'R0013:Kcns1'

32614

Institutional Source

Beutler Lab

Gene Symbol

Kcns1

Ensembl Gene

ENSMUSG00000040164

Gene Name

K+ voltage-gated channel, subfamily S, 1

Synonyms

Kv9.1

MMRRC Submission

038308-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.067) question?

Stock #

R0013 (G1)

Quality Score

182

Status

Validated

Chromosome

Chromosomal Location

164163619-164171113 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to T at 164168643 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 65 (D65E)

Ref Sequence

ENSEMBL: ENSMUSP00000038901 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000045196]

AlphaFold

O35173

Predicted Effect

probably benign
Transcript: ENSMUST00000045196
AA Change: D65E

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000038901
Gene: ENSMUSG00000040164
AA Change: D65E

Domain	Start	End	E-Value	Type
BTB	19	128	7.07e-7	SMART
low complexity region	160	175	N/A	INTRINSIC
Pfam:Ion_trans	188	439	2e-44	PFAM
Pfam:Ion_trans_2	349	433	5e-13	PFAM
low complexity region	455	468	N/A	INTRINSIC

Meta Mutation Damage Score

0.0814

Coding Region Coverage

1x: 99.2%
3x: 98.5%
10x: 96.9%
20x: 94.8%

Validation Efficiency

94% (79/84)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium channels form the largest and most diversified class of ion channels and are present in both excitable and nonexcitable cells. Their main functions are associated with the regulation of the resting membrane potential and the control of the shape and frequency of action potentials. The alpha subunits are of 2 types: those that are functional by themselves and those that are electrically silent but capable of modulating the activity of specific functional alpha subunits. The protein encoded by this gene is not functional by itself but can form heteromultimers with member 1 and with member 2 (and possibly other members) of the Shab-related subfamily of potassium voltage-gated channel proteins. This gene belongs to the S subfamily of the potassium channel family. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 79 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610028H24Rik	A	G	10: 76,457,512	M156V	probably benign	Het
Adnp2	A	T	18: 80,129,745	V483D	probably damaging	Het
Aff1	G	T	5: 103,828,484	E491*	probably null	Het
Agl	A	T	3: 116,776,608	C911*	probably null	Het
Akt2	A	G	7: 27,636,058	D284G	probably damaging	Het
Alox15	A	G	11: 70,349,635	M240T	possibly damaging	Het
Antxr2	A	G	5: 97,979,985	V229A	probably damaging	Het
Arap2	G	A	5: 62,683,484	L680F	probably damaging	Het
Btaf1	A	G	19: 36,958,373	T188A	probably benign	Het
Btnl6	G	A	17: 34,515,531	Q86*	probably null	Het
C2cd3	T	A	7: 100,416,062	L685H	probably damaging	Het
Cdh23	T	C	10: 60,413,173	T878A	possibly damaging	Het
Clec4b2	T	C	6: 123,202,149	Y137H	probably damaging	Het
Dchs1	T	A	7: 105,755,836	T2500S	possibly damaging	Het
Def6	A	G	17: 28,217,092	Y75C	probably damaging	Het
Dhx33	A	T	11: 70,993,635	F448L	probably damaging	Het
Dner	C	T	1: 84,494,893		probably benign	Het
Dnmbp	G	A	19: 43,902,231	P366S	probably benign	Het
Eif4g3	T	C	4: 138,175,848	C1160R	possibly damaging	Het
Elmod1	G	A	9: 53,912,901		probably benign	Het
Faah	C	A	4: 116,004,391	L305F	probably damaging	Het
Fam71b	A	G	11: 46,406,804	T312A	unknown	Het
Flt1	A	G	5: 147,571,014		probably benign	Het
Fyco1	A	T	9: 123,822,406	N1196K	probably benign	Het
Galnt18	T	C	7: 111,554,457	N320S	probably damaging	Het
Glp2r	C	A	11: 67,709,712	G437V	possibly damaging	Het
Gm4884	T	C	7: 41,044,292	S562P	probably damaging	Het
Gm9936	A	G	5: 114,857,347		probably benign	Het
Gpn2	C	A	4: 133,584,792	P112T	probably damaging	Het
Grm4	A	G	17: 27,431,575	Y816H	probably benign	Het
Helz2	A	T	2: 181,240,959	S14T	probably benign	Het
Htt	T	C	5: 34,820,104	L778P	probably benign	Het
Il11ra1	T	C	4: 41,765,060	S129P	probably damaging	Het
Ints11	T	C	4: 155,887,168	F315S	probably damaging	Het
Itga11	A	T	9: 62,776,613	N1059Y	possibly damaging	Het
Jak3	A	G	8: 71,684,327	S716G	probably damaging	Het
Kdm5d	A	T	Y: 941,715	K1305N	probably benign	Het
Kif26a	G	T	12: 112,177,880	V1523L	probably benign	Het
Mboat7	A	G	7: 3,683,822	S340P	probably damaging	Het
Mctp2	T	C	7: 72,229,408	I234V	probably benign	Het
Mex3c	G	A	18: 73,590,551	A572T	probably benign	Het
Mpp3	C	A	11: 102,005,425	R424L	probably benign	Het
Mroh4	T	A	15: 74,608,237		probably benign	Het
Myo9a	A	T	9: 59,860,206		probably benign	Het
Myog	T	A	1: 134,290,235	H60Q	probably damaging	Het
Nlrp9a	T	A	7: 26,571,225		probably null	Het
Notch1	A	G	2: 26,473,818	V868A	possibly damaging	Het
Olfr352	A	G	2: 36,870,160	N198S	probably damaging	Het
Olfr59	T	A	11: 74,289,051	I135N	possibly damaging	Het
Olfr73	T	C	2: 88,034,266	Y291C	possibly damaging	Het
Olfr980	A	T	9: 40,006,355	I198N	probably damaging	Het
Pink1	T	C	4: 138,317,401	T342A	probably benign	Het
Plb1	T	A	5: 32,349,615		probably benign	Het
Plec	T	C	15: 76,178,246	D2524G	probably damaging	Het
Plekhg4	G	T	8: 105,375,396	E6*	probably null	Het
Polq	T	C	16: 37,061,839	F1455S	possibly damaging	Het
Ppm1e	A	G	11: 87,249,058		probably benign	Het
Prkaca	G	A	8: 83,988,303	M119I	possibly damaging	Het
Prss46	G	T	9: 110,850,055	S108I	probably damaging	Het
Ptma	C	T	1: 86,529,776		probably benign	Het
Rab11fip4	C	T	11: 79,689,653	T437M	probably benign	Het
Rngtt	T	A	4: 33,379,409	M437K	probably benign	Het
Rrn3	T	A	16: 13,813,113	D604E	possibly damaging	Het
Scn4a	A	G	11: 106,348,405		probably benign	Het
Sis	A	G	3: 72,910,476	L1468P	possibly damaging	Het
Slit3	A	G	11: 35,707,918	M1450V	probably benign	Het
Smg5	T	C	3: 88,349,233	S269P	probably benign	Het
Sntg1	T	C	1: 8,463,462	T323A	probably damaging	Het
Son	C	T	16: 91,651,662	T37I	probably damaging	Het
Stk17b	T	C	1: 53,764,132	I41M	probably benign	Het
Tgm5	T	A	2: 121,076,882	Y120F	probably damaging	Het
Tppp	A	G	13: 74,021,360	K73R	possibly damaging	Het
Ttn	C	A	2: 76,739,158	K27130N	probably damaging	Het
Ttn	C	T	2: 76,907,752	V4148I	probably benign	Het
Uba7	A	T	9: 107,978,249	Y375F	probably damaging	Het
Ugcg	T	C	4: 59,213,931	L171P	possibly damaging	Het
Vsig2	T	C	9: 37,542,576		probably benign	Het
Zcchc11	T	A	4: 108,530,955		probably benign	Het
Zfp839	T	A	12: 110,868,386	S692T	possibly damaging	Het

Other mutations in Kcns1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
R0135:Kcns1	UTSW	2	164164955	missense	possibly damaging	0.90
R0241:Kcns1	UTSW	2	164168380	missense	probably damaging	1.00
R1966:Kcns1	UTSW	2	164168535	missense	probably damaging	1.00
R2877:Kcns1	UTSW	2	164164762	missense	probably damaging	1.00
R2878:Kcns1	UTSW	2	164164762	missense	probably damaging	1.00
R3157:Kcns1	UTSW	2	164164945	missense	probably damaging	1.00
R4013:Kcns1	UTSW	2	164168257	missense	probably damaging	1.00
R4451:Kcns1	UTSW	2	164168678	missense	possibly damaging	0.46
R4873:Kcns1	UTSW	2	164168101	missense	probably damaging	1.00
R4875:Kcns1	UTSW	2	164168101	missense	probably damaging	1.00
R5270:Kcns1	UTSW	2	164168329	missense	probably benign	0.37
R5493:Kcns1	UTSW	2	164167979	missense	probably benign	0.02
R5775:Kcns1	UTSW	2	164164766	missense	probably damaging	0.99
R6931:Kcns1	UTSW	2	164164838	missense	probably damaging	0.99
R7689:Kcns1	UTSW	2	164168321	missense	probably damaging	1.00
R8304:Kcns1	UTSW	2	164168102	missense	probably damaging	1.00
R9044:Kcns1	UTSW	2	164168076	missense	probably damaging	1.00
R9195:Kcns1	UTSW	2	164167858	missense	probably damaging	1.00
R9414:Kcns1	UTSW	2	164168458	missense	probably damaging	1.00
Z1176:Kcns1	UTSW	2	164168633	missense	probably benign	0.02

Predicted Primers

PCR Primer
(F):5'- AAGCGATGCAGAAGTACTCCAGGC -3'
(R):5'- GGGATTTTAACCAACAGGGAGGCAC -3'

Sequencing Primer
(F):5'- AGCGAGTAGCCTGGATTCTC -3'
(R):5'- GAGGCACACTGTCGTAGC -3'

Posted On

2013-05-09