Incidental Mutation 'R0013:Agl'
ID32618
Institutional Source Beutler Lab
Gene Symbol Agl
Ensembl Gene ENSMUSG00000033400
Gene Nameamylo-1,6-glucosidase, 4-alpha-glucanotransferase
Synonyms9430004C13Rik, 9630046L06Rik, 1110061O17Rik
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.285) question?
Stock #R0013 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location116739999-116808166 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 116776608 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 911 (C911*)
Ref Sequence ENSEMBL: ENSMUSP00000124149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040603] [ENSMUST00000159742] [ENSMUST00000161336] [ENSMUST00000162792]
Predicted Effect probably null
Transcript: ENSMUST00000040603
AA Change: C911*
SMART Domains Protein: ENSMUSP00000044012
Gene: ENSMUSG00000033400
AA Change: C911*

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 4.8e-24 PFAM
Pfam:hDGE_amylase 120 550 9.6e-167 PFAM
Pfam:hGDE_central 697 974 2e-90 PFAM
Pfam:GDE_C 1044 1527 8.5e-145 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159742
AA Change: C911*
SMART Domains Protein: ENSMUSP00000143582
Gene: ENSMUSG00000033400
AA Change: C911*

DomainStartEndE-ValueType
Pfam:hGDE_N 31 116 2.1e-20 PFAM
Pfam:hDGE_amylase 120 550 7.8e-164 PFAM
Pfam:hGDE_central 697 974 6.2e-87 PFAM
Pfam:GDE_C 1043 1279 6.7e-61 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000159995
SMART Domains Protein: ENSMUSP00000125246
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_central 119 197 8.8e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160484
AA Change: C246*
SMART Domains Protein: ENSMUSP00000123985
Gene: ENSMUSG00000033400
AA Change: C246*

DomainStartEndE-ValueType
Pfam:hGDE_central 33 310 2.8e-87 PFAM
Pfam:GDE_C 379 830 1.3e-126 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161336
SMART Domains Protein: ENSMUSP00000123877
Gene: ENSMUSG00000033400

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 2.1e-29 PFAM
Pfam:hDGE_amylase 120 230 3.7e-43 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000162792
AA Change: C911*
SMART Domains Protein: ENSMUSP00000124149
Gene: ENSMUSG00000033400
AA Change: C911*

DomainStartEndE-ValueType
Pfam:hGDE_N 30 117 4e-28 PFAM
Pfam:hDGE_amylase 120 550 1.4e-167 PFAM
Pfam:hGDE_central 697 975 5.6e-95 PFAM
Pfam:GDE_C 1061 1527 1.1e-137 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the glycogen debrancher enzyme which is involved in glycogen degradation. This enzyme has two independent catalytic activities which occur at different sites on the protein: a 4-alpha-glucotransferase activity and a amylo-1,6-glucosidase activity. Mutations in this gene are associated with glycogen storage disease although a wide range of enzymatic and clinical variability occurs which may be due to tissue-specific alternative splicing. Alternatively spliced transcripts encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to hypoglycemia, altered blood biochemistry, severe hepatomegaly, glycogen accumulation in the liver, heart, skeletal muscle and other tissues, motor impairment, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Agl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00235:Agl APN 3 116771483 missense probably benign 0.10
IGL00500:Agl APN 3 116772820 missense probably damaging 1.00
IGL00691:Agl APN 3 116779258 missense possibly damaging 0.46
IGL00711:Agl APN 3 116793627 missense probably damaging 1.00
IGL01291:Agl APN 3 116772789 missense possibly damaging 0.49
IGL01641:Agl APN 3 116784455 nonsense probably null
IGL01860:Agl APN 3 116772526 splice site probably benign
IGL01893:Agl APN 3 116788549 missense probably damaging 0.97
IGL02193:Agl APN 3 116779166 missense probably damaging 0.99
IGL02379:Agl APN 3 116779091 missense probably damaging 1.00
IGL02485:Agl APN 3 116779080 missense probably benign
IGL02644:Agl APN 3 116786597 missense probably damaging 1.00
IGL02673:Agl APN 3 116781599 missense probably benign 0.01
IGL02693:Agl APN 3 116746428 missense possibly damaging 0.67
IGL02733:Agl APN 3 116780997 missense probably benign
IGL03089:Agl APN 3 116781023 missense probably damaging 1.00
IGL03271:Agl APN 3 116779127 missense probably benign 0.00
ANU05:Agl UTSW 3 116772789 missense possibly damaging 0.49
PIT4445001:Agl UTSW 3 116771460 missense
R0013:Agl UTSW 3 116776608 nonsense probably null
R0022:Agl UTSW 3 116793836 splice site probably null
R0092:Agl UTSW 3 116793804 missense probably damaging 1.00
R0226:Agl UTSW 3 116752071 missense probably damaging 1.00
R0440:Agl UTSW 3 116758806 missense probably damaging 1.00
R0488:Agl UTSW 3 116754962 nonsense probably null
R0504:Agl UTSW 3 116786784 missense probably damaging 0.99
R0689:Agl UTSW 3 116793628 missense probably damaging 1.00
R0715:Agl UTSW 3 116752176 missense probably damaging 1.00
R0893:Agl UTSW 3 116753286 missense probably benign 0.04
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1403:Agl UTSW 3 116782597 missense probably benign 0.12
R1432:Agl UTSW 3 116746693 missense probably damaging 1.00
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1465:Agl UTSW 3 116771372 missense probably benign 0.35
R1540:Agl UTSW 3 116780735 missense probably benign 0.01
R1624:Agl UTSW 3 116787246 missense probably benign 0.30
R1640:Agl UTSW 3 116752090 missense probably benign 0.02
R1834:Agl UTSW 3 116788351 missense probably benign 0.31
R1853:Agl UTSW 3 116779322 nonsense probably null
R2004:Agl UTSW 3 116781265 missense probably damaging 1.00
R2184:Agl UTSW 3 116780777 missense probably benign 0.00
R2227:Agl UTSW 3 116788312 missense possibly damaging 0.78
R3053:Agl UTSW 3 116791033 missense probably damaging 1.00
R4181:Agl UTSW 3 116746630 missense probably damaging 1.00
R4241:Agl UTSW 3 116754848 intron probably benign
R4284:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4285:Agl UTSW 3 116752178 missense possibly damaging 0.83
R4302:Agl UTSW 3 116746630 missense probably damaging 1.00
R4791:Agl UTSW 3 116786528 critical splice donor site probably null
R4854:Agl UTSW 3 116778618 critical splice donor site probably null
R4968:Agl UTSW 3 116788526 missense probably benign 0.31
R5075:Agl UTSW 3 116793807 missense probably damaging 1.00
R5219:Agl UTSW 3 116778721 missense possibly damaging 0.81
R5274:Agl UTSW 3 116772486 missense probably damaging 1.00
R5347:Agl UTSW 3 116791165 missense probably damaging 1.00
R5399:Agl UTSW 3 116781628 missense probably damaging 1.00
R5511:Agl UTSW 3 116788560 missense possibly damaging 0.81
R5763:Agl UTSW 3 116753360 missense probably damaging 1.00
R5827:Agl UTSW 3 116781054 missense probably damaging 1.00
R5964:Agl UTSW 3 116793774 missense probably damaging 1.00
R5967:Agl UTSW 3 116793708 missense probably benign 0.06
R5986:Agl UTSW 3 116772496 missense probably damaging 1.00
R6127:Agl UTSW 3 116758329 missense probably damaging 1.00
R6209:Agl UTSW 3 116785196 nonsense probably null
R6252:Agl UTSW 3 116787229 critical splice donor site probably null
R6337:Agl UTSW 3 116786777 missense possibly damaging 0.65
R6366:Agl UTSW 3 116791117 missense probably damaging 1.00
R6441:Agl UTSW 3 116771459 missense probably benign 0.21
R6647:Agl UTSW 3 116750411 missense probably damaging 1.00
R6678:Agl UTSW 3 116753320 missense probably damaging 0.99
R6736:Agl UTSW 3 116781680 missense probably damaging 0.98
R7141:Agl UTSW 3 116753286 missense probably benign 0.04
R7143:Agl UTSW 3 116792021 missense probably damaging 0.99
R7204:Agl UTSW 3 116793820 missense probably benign 0.04
R7259:Agl UTSW 3 116784581 missense probably damaging 1.00
R7393:Agl UTSW 3 116791156 missense probably benign
R7426:Agl UTSW 3 116758755 missense
R7559:Agl UTSW 3 116752115 missense
R7587:Agl UTSW 3 116792087 missense probably damaging 1.00
R7609:Agl UTSW 3 116807279 missense possibly damaging 0.93
R7657:Agl UTSW 3 116779163 missense
R7715:Agl UTSW 3 116758256 missense
R7735:Agl UTSW 3 116785146 missense probably benign 0.21
R7770:Agl UTSW 3 116758237 critical splice donor site probably null
R7980:Agl UTSW 3 116792181 missense probably benign 0.08
R8186:Agl UTSW 3 116758908 missense possibly damaging 0.92
R8215:Agl UTSW 3 116788644 missense probably damaging 1.00
R8336:Agl UTSW 3 116772846 missense
X0065:Agl UTSW 3 116781330 nonsense probably null
Z1177:Agl UTSW 3 116781036 missense
Predicted Primers PCR Primer
(F):5'- GGGGTTCAGAAAGGCTATGCTACTAATG -3'
(R):5'- gccgatcagaagttcaGAAGATCACA -3'

Sequencing Primer
(F):5'- GGCTATGCTACTAATGGTAACCAAC -3'
(R):5'- tcaaaccatcacagacccc -3'
Posted On2013-05-09