Incidental Mutation 'R4385:Rbp3'
ID326185
Institutional Source Beutler Lab
Gene Symbol Rbp3
Ensembl Gene ENSMUSG00000041534
Gene Nameretinol binding protein 3, interstitial
SynonymsRbp-3, Irbp
MMRRC Submission 041124-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.666) question?
Stock #R4385 (G1)
Quality Score225
Status Not validated
Chromosome14
Chromosomal Location33954003-33964216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 33955296 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 400 (E400D)
Ref Sequence ENSEMBL: ENSMUSP00000040249 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035695]
Predicted Effect probably benign
Transcript: ENSMUST00000035695
AA Change: E400D

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000040249
Gene: ENSMUSG00000041534
AA Change: E400D

DomainStartEndE-ValueType
signal peptide 1 17 N/A INTRINSIC
TSPc 109 308 5.72e-69 SMART
TSPc 416 616 1.98e-63 SMART
TSPc 720 917 5.34e-69 SMART
TSPc 1019 1216 2.13e-68 SMART
Meta Mutation Damage Score 0.1268 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Interphotoreceptor retinol-binding protein is a large glycoprotein known to bind retinoids and found primarily in the interphotoreceptor matrix of the retina between the retinal pigment epithelium and the photoreceptor cells. It is thought to transport retinoids between the retinal pigment epithelium and the photoreceptors, a critical role in the visual process.The human IRBP gene is approximately 9.5 kbp in length and consists of four exons separated by three introns. The introns are 1.6-1.9 kbp long. The gene is transcribed by photoreceptor and retinoblastoma cells into an approximately 4.3-kilobase mRNA that is translated and processed into a glycosylated protein of 135,000 Da. The amino acid sequence of human IRBP can be divided into four contiguous homology domains with 33-38% identity, suggesting a series of gene duplication events. In the gene, the boundaries of these domains are not defined by exon-intron junctions, as might have been expected. The first three homology domains and part of the fourth are all encoded by the first large exon, which is 3,180 base pairs long. The remainder of the fourth domain is encoded in the last three exons, which are 191, 143, and approximately 740 base pairs long, respectively. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for disruptions in this gene experience photoreceptor degeneration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,208 S251P possibly damaging Het
A530032D15Rik C T 1: 85,109,336 probably null Het
Abcc3 A T 11: 94,368,239 I426N probably damaging Het
Abcc6 C T 7: 45,995,328 V808I possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Apbb1 A G 7: 105,567,276 S140P probably benign Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cdc27 T C 11: 104,534,814 R59G probably benign Het
Cfap43 T C 19: 47,797,129 R441G probably benign Het
Chsy3 A G 18: 59,176,352 I226V probably benign Het
Chsy3 A T 18: 59,179,474 T340S possibly damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Col5a1 A C 2: 28,024,779 M136L probably damaging Het
Coro2a A T 4: 46,541,961 I387N possibly damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Cyfip2 C T 11: 46,242,403 M823I probably benign Het
Dcbld2 A G 16: 58,463,066 K555E probably damaging Het
Dpep3 A G 8: 105,978,186 M164T probably damaging Het
Flg C A 3: 93,293,009 probably benign Het
Gm13089 C T 4: 143,698,014 probably null Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Ift172 T C 5: 31,286,967 D37G probably damaging Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk1 A T 7: 44,228,569 D83V probably benign Het
Klk9 T C 7: 43,794,275 V71A probably benign Het
Loxhd1 A G 18: 77,372,911 K806R probably damaging Het
Metap1 T C 3: 138,475,063 E119G possibly damaging Het
Nbea T C 3: 56,000,638 H1351R possibly damaging Het
Nim1k T C 13: 119,712,626 D244G probably damaging Het
Npas1 C T 7: 16,459,185 probably null Het
Pcdh15 A G 10: 74,550,490 D1136G probably damaging Het
Pde6b A G 5: 108,427,642 I657V probably benign Het
Pi4ka A G 16: 17,386,265 V55A probably benign Het
Plxnb2 T C 15: 89,160,623 N1173S probably damaging Het
Ptpn13 T C 5: 103,533,407 probably null Het
Ptprb A G 10: 116,346,867 S1483G probably benign Het
Rbm48 G A 5: 3,590,300 P360S probably damaging Het
Rfpl4 A G 7: 5,110,670 S165P possibly damaging Het
Scn9a A T 2: 66,484,556 L1595Q probably damaging Het
Scp2 A T 4: 108,071,350 V381D probably damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Slc30a9 T C 5: 67,315,767 Y65H probably damaging Het
Sorcs1 A G 19: 50,190,161 I841T probably benign Het
Spag7 C T 11: 70,669,203 A27T probably damaging Het
St6galnac6 A G 2: 32,615,024 I181V possibly damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Ugt3a1 C T 15: 9,306,479 S238F probably benign Het
Usp9y G A Y: 1,304,756 L2363F probably damaging Het
Vmn1r34 T A 6: 66,637,139 H205L probably damaging Het
Vps50 C A 6: 3,516,694 Q59K probably benign Het
Zeb2 T A 2: 45,023,062 D39V probably damaging Het
Zfp146 G A 7: 30,162,422 T65I probably benign Het
Zfp36 T C 7: 28,377,691 D264G probably benign Het
Other mutations in Rbp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01364:Rbp3 APN 14 33954188 missense possibly damaging 0.82
IGL01643:Rbp3 APN 14 33956836 missense probably benign 0.18
IGL01665:Rbp3 APN 14 33956131 missense probably benign 0.02
IGL01809:Rbp3 APN 14 33955300 missense probably damaging 1.00
IGL01975:Rbp3 APN 14 33958645 missense probably damaging 1.00
IGL02349:Rbp3 APN 14 33955719 missense probably damaging 0.97
IGL02447:Rbp3 APN 14 33954503 missense probably damaging 1.00
IGL03192:Rbp3 APN 14 33958583 missense possibly damaging 0.52
IGL03302:Rbp3 APN 14 33954659 missense probably damaging 0.97
behagt UTSW 14 33954454 missense probably benign 0.00
jagt UTSW 14 33956482 missense probably damaging 0.97
muntre UTSW 14 33956356 missense possibly damaging 0.95
rotwild UTSW 14 33956018 missense probably damaging 1.00
P4717OSA:Rbp3 UTSW 14 33955499 missense probably damaging 0.96
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0234:Rbp3 UTSW 14 33955901 missense probably damaging 0.98
R0432:Rbp3 UTSW 14 33954773 missense probably damaging 1.00
R0469:Rbp3 UTSW 14 33962419 missense possibly damaging 0.95
R0652:Rbp3 UTSW 14 33958648 missense possibly damaging 0.89
R0739:Rbp3 UTSW 14 33958647 missense probably benign 0.28
R0747:Rbp3 UTSW 14 33956278 missense possibly damaging 0.51
R0836:Rbp3 UTSW 14 33956638 missense possibly damaging 0.84
R1102:Rbp3 UTSW 14 33956356 missense possibly damaging 0.95
R1583:Rbp3 UTSW 14 33954524 missense possibly damaging 0.45
R1589:Rbp3 UTSW 14 33955792 missense probably damaging 0.99
R1595:Rbp3 UTSW 14 33956198 missense possibly damaging 0.93
R1720:Rbp3 UTSW 14 33956909 missense probably benign 0.38
R1830:Rbp3 UTSW 14 33954644 missense probably benign 0.31
R1982:Rbp3 UTSW 14 33954545 missense probably damaging 0.99
R1985:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R1985:Rbp3 UTSW 14 33956461 missense probably benign 0.00
R2007:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2027:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2100:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2101:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2113:Rbp3 UTSW 14 33956057 missense probably benign 0.00
R2138:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2183:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2248:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2277:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2306:Rbp3 UTSW 14 33962563 missense probably damaging 1.00
R2504:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2696:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2697:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2698:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2920:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2940:Rbp3 UTSW 14 33956018 missense probably damaging 1.00
R2971:Rbp3 UTSW 14 33954454 missense probably benign 0.00
R3111:Rbp3 UTSW 14 33954112 missense probably benign 0.01
R3155:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3156:Rbp3 UTSW 14 33957114 missense probably damaging 0.98
R3751:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3752:Rbp3 UTSW 14 33956012 missense probably damaging 0.98
R3851:Rbp3 UTSW 14 33955507 missense probably damaging 0.98
R4016:Rbp3 UTSW 14 33955390 missense possibly damaging 0.82
R4276:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4277:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4278:Rbp3 UTSW 14 33958650 missense probably benign 0.24
R4382:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4383:Rbp3 UTSW 14 33955296 missense probably benign 0.12
R4625:Rbp3 UTSW 14 33956099 missense probably benign
R4712:Rbp3 UTSW 14 33960658 missense probably damaging 0.97
R4812:Rbp3 UTSW 14 33954774 missense probably damaging 0.99
R4918:Rbp3 UTSW 14 33955411 missense probably damaging 1.00
R4971:Rbp3 UTSW 14 33954470 missense probably damaging 0.98
R5262:Rbp3 UTSW 14 33954850 missense probably damaging 1.00
R5387:Rbp3 UTSW 14 33956413 missense possibly damaging 0.95
R5468:Rbp3 UTSW 14 33956627 missense possibly damaging 0.93
R5837:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R5994:Rbp3 UTSW 14 33954900 missense probably damaging 1.00
R6010:Rbp3 UTSW 14 33954647 missense probably damaging 1.00
R6041:Rbp3 UTSW 14 33956482 missense probably damaging 0.97
R6266:Rbp3 UTSW 14 33954461 missense probably benign
R6357:Rbp3 UTSW 14 33957034 missense probably damaging 0.99
R6457:Rbp3 UTSW 14 33955267 nonsense probably null
R6777:Rbp3 UTSW 14 33954273 missense probably benign 0.00
R7158:Rbp3 UTSW 14 33955556 missense probably benign 0.00
R7183:Rbp3 UTSW 14 33955204 missense probably benign 0.02
R7256:Rbp3 UTSW 14 33962583 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ACATTAGTGGACCGAGTGC -3'
(R):5'- CAGGTCCATGATGAGGTGTTC -3'

Sequencing Primer
(F):5'- CAAAGCTCAATGCTGGCT -3'
(R):5'- TTCCGTGTCCTGCAAAGG -3'
Posted On2015-07-06