Incidental Mutation 'R4386:Fah'
ID 326225
Institutional Source Beutler Lab
Gene Symbol Fah
Ensembl Gene ENSMUSG00000030630
Gene Name fumarylacetoacetate hydrolase
Synonyms
MMRRC Submission 041680-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R4386 (G1)
Quality Score 225
Status Validated
Chromosome 7
Chromosomal Location 84585159-84606722 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 84599136 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Serine at position 125 (T125S)
Ref Sequence ENSEMBL: ENSMUSP00000032865 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032865] [ENSMUST00000128460]
AlphaFold P35505
PDB Structure CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH 4-(HYDROXYMETHYLPHOSPHINOYL)-3-OXO-BUTANOIC ACID [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF FUMARYLACETOACETATE HYDROLASE COMPLEXED WITH FUMARATE AND ACETOACETATE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF MOUSE FUMARYLACETOACETATE HYDROLASE REFINED AT 1.55 ANGSTROM RESOLUTION [X-RAY DIFFRACTION]
Mouse fumarylacetoacetate hydrolase complexes with a transition-state mimic of the complete substrate [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000032865
AA Change: T125S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032865
Gene: ENSMUSG00000030630
AA Change: T125S

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 15 118 1.7e-36 PFAM
Pfam:FAA_hydrolase 123 413 1e-58 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000128460
AA Change: T55S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000121439
Gene: ENSMUSG00000030630
AA Change: T55S

DomainStartEndE-ValueType
Pfam:FAA_hydrolase_N 1 48 7.2e-10 PFAM
Pfam:FAA_hydrolase 53 140 7.3e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134390
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153126
Predicted Effect noncoding transcript
Transcript: ENSMUST00000209112
Meta Mutation Damage Score 0.8530 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the last enzyme in the tyrosine catabolism pathway. FAH deficiency is associated with Type 1 hereditary tyrosinemia (HT). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted, deletion, and ENU-induced mutations die perinatally with liver and kidney dysfunction, hypoglycemia, and grossly altered liver mRNA expression. Mice homozygous for a mutation of this gene exhibit inappropriate bouts of activity during the light period of the circadian cycle. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,241,921 probably null Het
Acsm3 G T 7: 119,773,871 W199L probably damaging Het
Arap1 T A 7: 101,385,571 D236E probably benign Het
Arhgap1 T C 2: 91,668,237 Y160H probably damaging Het
Arid1b A G 17: 4,994,972 probably benign Het
Cdc25a A G 9: 109,889,733 E334G probably damaging Het
Ciz1 C T 2: 32,370,099 T219M possibly damaging Het
Cluap1 A C 16: 3,933,722 D315A possibly damaging Het
Cps1 T C 1: 67,170,995 probably null Het
Cul2 T C 18: 3,434,856 S668P probably damaging Het
Fam129c A G 8: 71,607,511 probably benign Het
Fam221a G A 6: 49,378,432 C156Y probably damaging Het
Gm6158 G T 14: 24,070,294 noncoding transcript Het
Hbq1b T A 11: 32,287,295 V63E probably damaging Het
Ighv6-5 G A 12: 114,416,717 T79I possibly damaging Het
Kif12 G A 4: 63,171,218 T99M probably damaging Het
Kif1a T A 1: 93,068,550 K298M probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
March4 G A 1: 72,428,814 P353L probably benign Het
Nadk A T 4: 155,582,575 probably benign Het
Ncoa2 T C 1: 13,177,165 T345A probably damaging Het
Nsun6 T A 2: 14,996,522 M408L probably benign Het
Nuak1 T A 10: 84,394,044 E155V probably damaging Het
Olfr1395 T A 11: 49,149,015 Y253N probably damaging Het
Olfr157 C T 4: 43,836,124 R122H probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr510 T A 7: 108,668,253 V279E probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Pabpc2 T C 18: 39,775,185 V501A probably benign Het
Pik3c2a A G 7: 116,354,099 V1187A probably damaging Het
Pkhd1 A G 1: 20,414,292 V2013A probably benign Het
Psmd1 T A 1: 86,128,192 S759T possibly damaging Het
Scgb1b2 T A 7: 31,290,664 K86N possibly damaging Het
Sdk1 T C 5: 142,094,626 I1291T probably damaging Het
Skint5 T C 4: 113,483,893 Y1396C probably benign Het
Slc24a3 A G 2: 145,606,826 E380G probably benign Het
Spock1 A G 13: 57,440,450 S270P probably damaging Het
Tmem128 T C 5: 38,262,074 S57P probably damaging Het
Tmem186 G A 16: 8,636,023 R125W probably benign Het
Tnfaip3 A G 10: 19,007,010 S220P probably damaging Het
Usp45 T C 4: 21,830,505 probably null Het
Usp5 C T 6: 124,818,474 probably null Het
Vmn1r35 A T 6: 66,679,589 C32* probably null Het
Vmn2r112 T A 17: 22,601,322 F59I probably benign Het
Wfdc9 A T 2: 164,650,538 S56R probably benign Het
Zfp369 A G 13: 65,296,992 I650V probably benign Het
Other mutations in Fah
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01798:Fah APN 7 84589629 missense probably benign 0.33
IGL02374:Fah APN 7 84605701 missense probably benign 0.02
IGL02975:Fah APN 7 84601079 missense probably benign 0.00
IGL03403:Fah APN 7 84593209 missense probably damaging 1.00
R0245:Fah UTSW 7 84595498 missense probably benign
R0689:Fah UTSW 7 84593184 critical splice donor site probably null
R1173:Fah UTSW 7 84601136 start codon destroyed probably null 1.00
R1413:Fah UTSW 7 84593212 missense probably damaging 0.99
R1995:Fah UTSW 7 84602181 missense probably damaging 1.00
R2150:Fah UTSW 7 84594834 missense probably damaging 1.00
R3612:Fah UTSW 7 84585290 missense probably damaging 0.98
R3620:Fah UTSW 7 84588951 splice site probably null
R4360:Fah UTSW 7 84589648 missense probably damaging 1.00
R4923:Fah UTSW 7 84602052 intron probably benign
R5151:Fah UTSW 7 84601051 missense possibly damaging 0.87
R5443:Fah UTSW 7 84592396 missense probably damaging 0.96
R5470:Fah UTSW 7 84593185 critical splice donor site probably null
R5976:Fah UTSW 7 84594741 missense probably benign 0.00
R6086:Fah UTSW 7 84588912 missense probably damaging 1.00
R6272:Fah UTSW 7 84595545 missense probably damaging 1.00
R6502:Fah UTSW 7 84594835 missense probably damaging 1.00
R6586:Fah UTSW 7 84593260 missense probably benign 0.04
R7522:Fah UTSW 7 84597074 missense probably benign 0.00
R7832:Fah UTSW 7 84595478 missense probably damaging 1.00
R8535:Fah UTSW 7 84601097 missense probably benign
R8823:Fah UTSW 7 84605717 missense possibly damaging 0.85
RF002:Fah UTSW 7 84589628 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTCTTTCTAGAGGACGCAAC -3'
(R):5'- AGGGTACTGGCAGCTACTTC -3'

Sequencing Primer
(F):5'- GAGGACGCAACATCATCAGTTTTG -3'
(R):5'- ACTGGCAGCTACTTCATATTTAAATC -3'
Posted On 2015-07-06