Incidental Mutation 'R4386:Acsm3'
ID326230
Institutional Source Beutler Lab
Gene Symbol Acsm3
Ensembl Gene ENSMUSG00000030935
Gene Nameacyl-CoA synthetase medium-chain family member 3
SynonymsSah, Sa
MMRRC Submission 041680-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4386 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location119760923-119787513 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 119773871 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Leucine at position 199 (W199L)
Ref Sequence ENSEMBL: ENSMUSP00000102139 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063770] [ENSMUST00000063902] [ENSMUST00000106523] [ENSMUST00000106526] [ENSMUST00000106527] [ENSMUST00000106528] [ENSMUST00000106529]
Predicted Effect probably damaging
Transcript: ENSMUST00000063770
AA Change: W199L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000068803
Gene: ENSMUSG00000030935
AA Change: W199L

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000063902
SMART Domains Protein: ENSMUSP00000068633
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
transmembrane domain 245 262 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106523
SMART Domains Protein: ENSMUSP00000102133
Gene: ENSMUSG00000030929

DomainStartEndE-ValueType
EXOIII 36 235 1.41e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106526
AA Change: W199L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102136
Gene: ENSMUSG00000030935
AA Change: W199L

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106527
AA Change: W199L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102137
Gene: ENSMUSG00000030935
AA Change: W199L

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106528
AA Change: W199L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102138
Gene: ENSMUSG00000030935
AA Change: W199L

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 3.7e-86 PFAM
Pfam:AMP-binding_C 486 566 1.8e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000106529
AA Change: W199L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102139
Gene: ENSMUSG00000030935
AA Change: W199L

DomainStartEndE-ValueType
Pfam:AMP-binding 65 478 1.1e-78 PFAM
Pfam:AMP-binding_C 486 566 9.3e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149598
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149766
Meta Mutation Damage Score 0.7464 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Homozygous null mice are viable and fertile with normal kidney function and morphology and blood pressure similar to wild-type on either a regular or high salt diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,241,921 probably null Het
Arap1 T A 7: 101,385,571 D236E probably benign Het
Arhgap1 T C 2: 91,668,237 Y160H probably damaging Het
Arid1b A G 17: 4,994,972 probably benign Het
Cdc25a A G 9: 109,889,733 E334G probably damaging Het
Ciz1 C T 2: 32,370,099 T219M possibly damaging Het
Cluap1 A C 16: 3,933,722 D315A possibly damaging Het
Cps1 T C 1: 67,170,995 probably null Het
Cul2 T C 18: 3,434,856 S668P probably damaging Het
Fah T A 7: 84,599,136 T125S probably damaging Het
Fam129c A G 8: 71,607,511 probably benign Het
Fam221a G A 6: 49,378,432 C156Y probably damaging Het
Gm6158 G T 14: 24,070,294 noncoding transcript Het
Hbq1b T A 11: 32,287,295 V63E probably damaging Het
Ighv6-5 G A 12: 114,416,717 T79I possibly damaging Het
Kif12 G A 4: 63,171,218 T99M probably damaging Het
Kif1a T A 1: 93,068,550 K298M probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
March4 G A 1: 72,428,814 P353L probably benign Het
Nadk A T 4: 155,582,575 probably benign Het
Ncoa2 T C 1: 13,177,165 T345A probably damaging Het
Nsun6 T A 2: 14,996,522 M408L probably benign Het
Nuak1 T A 10: 84,394,044 E155V probably damaging Het
Olfr1395 T A 11: 49,149,015 Y253N probably damaging Het
Olfr157 C T 4: 43,836,124 R122H probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr510 T A 7: 108,668,253 V279E probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Pabpc2 T C 18: 39,775,185 V501A probably benign Het
Pik3c2a A G 7: 116,354,099 V1187A probably damaging Het
Pkhd1 A G 1: 20,414,292 V2013A probably benign Het
Psmd1 T A 1: 86,128,192 S759T possibly damaging Het
Scgb1b2 T A 7: 31,290,664 K86N possibly damaging Het
Sdk1 T C 5: 142,094,626 I1291T probably damaging Het
Skint5 T C 4: 113,483,893 Y1396C probably benign Het
Slc24a3 A G 2: 145,606,826 E380G probably benign Het
Spock1 A G 13: 57,440,450 S270P probably damaging Het
Tmem128 T C 5: 38,262,074 S57P probably damaging Het
Tmem186 G A 16: 8,636,023 R125W probably benign Het
Tnfaip3 A G 10: 19,007,010 S220P probably damaging Het
Usp45 T C 4: 21,830,505 probably null Het
Usp5 C T 6: 124,818,474 probably null Het
Vmn1r35 A T 6: 66,679,589 C32* probably null Het
Vmn2r112 T A 17: 22,601,322 F59I probably benign Het
Wfdc9 A T 2: 164,650,538 S56R probably benign Het
Zfp369 A G 13: 65,296,992 I650V probably benign Het
Other mutations in Acsm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00500:Acsm3 APN 7 119784344 missense probably damaging 1.00
IGL01434:Acsm3 APN 7 119781074 unclassified probably benign
IGL01446:Acsm3 APN 7 119778454 missense probably damaging 1.00
IGL01800:Acsm3 APN 7 119774643 missense possibly damaging 0.68
IGL01882:Acsm3 APN 7 119774635 missense probably damaging 0.99
IGL01954:Acsm3 APN 7 119775083 splice site probably benign
PIT4677001:Acsm3 UTSW 7 119775117 missense probably damaging 1.00
PIT4696001:Acsm3 UTSW 7 119784986 splice site probably null
R0422:Acsm3 UTSW 7 119773740 nonsense probably null
R0423:Acsm3 UTSW 7 119777159 missense probably damaging 1.00
R0729:Acsm3 UTSW 7 119783984 utr 3 prime probably benign
R0731:Acsm3 UTSW 7 119768024 nonsense probably null
R0732:Acsm3 UTSW 7 119773834 missense probably benign 0.40
R0744:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R0836:Acsm3 UTSW 7 119777100 missense possibly damaging 0.84
R1926:Acsm3 UTSW 7 119777136 missense probably damaging 1.00
R2104:Acsm3 UTSW 7 119784304 missense probably benign
R2429:Acsm3 UTSW 7 119768000 missense probably benign
R3940:Acsm3 UTSW 7 119773886 missense probably benign 0.03
R5437:Acsm3 UTSW 7 119778497 intron probably benign
R5890:Acsm3 UTSW 7 119775234 missense probably benign
R6278:Acsm3 UTSW 7 119773849 missense probably damaging 1.00
R6350:Acsm3 UTSW 7 119768033 missense probably benign
R6497:Acsm3 UTSW 7 119780749 critical splice acceptor site probably null
R6582:Acsm3 UTSW 7 119779673 missense probably benign
R6670:Acsm3 UTSW 7 119780755 unclassified probably null
R6939:Acsm3 UTSW 7 119778455 missense probably damaging 1.00
R7037:Acsm3 UTSW 7 119768043 missense probably damaging 1.00
R7087:Acsm3 UTSW 7 119774647 missense probably damaging 1.00
R7301:Acsm3 UTSW 7 119777085 missense possibly damaging 0.92
R7381:Acsm3 UTSW 7 119780826 missense probably damaging 0.98
R7396:Acsm3 UTSW 7 119773829 missense probably damaging 1.00
R7594:Acsm3 UTSW 7 119784990 splice site probably null
Predicted Primers PCR Primer
(F):5'- CTAGGGACAGTTTTAATTCCAGGAAC -3'
(R):5'- TTTTATCGCCAGCAGACCCC -3'

Sequencing Primer
(F):5'- GTTTTAATTCCAGGAACCACTCAGC -3'
(R):5'- AAGCTTGCACTGCCAACTGTTAG -3'
Posted On2015-07-06