Incidental Mutation 'R4387:Olfr1080'
ID 326252
Institutional Source Beutler Lab
Gene Symbol Olfr1080
Ensembl Gene ENSMUSG00000110912
Gene Name olfactory receptor 1080
Synonyms MOR192-1, GA_x6K02T2Q125-48039418-48038477
MMRRC Submission 041681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.069) question?
Stock # R4387 (G1)
Quality Score 225
Status Not validated
Chromosome 2
Chromosomal Location 86552675-86558235 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 86553954 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 57 (T57A)
Ref Sequence ENSEMBL: ENSMUSP00000150502 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000213185]
AlphaFold Q7TR67
Predicted Effect probably damaging
Transcript: ENSMUST00000099881
AA Change: T57A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000097466
Gene: ENSMUSG00000075178
AA Change: T57A

DomainStartEndE-ValueType
Pfam:7tm_1 41 290 1.5e-30 PFAM
Pfam:7tm_4 139 283 1.4e-44 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213185
AA Change: T57A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,574 probably null Het
9930021J03Rik A G 19: 29,805,315 probably benign Het
Adprm C T 11: 67,038,193 R324K probably benign Het
AI481877 A T 4: 59,060,915 C953S possibly damaging Het
Calcr T A 6: 3,707,581 N240Y probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cp T C 3: 19,977,202 V601A probably damaging Het
Cyp2a5 A G 7: 26,841,054 D364G probably damaging Het
Eno4 T A 19: 58,953,208 V187D probably benign Het
Fbxl7 C A 15: 26,543,259 S434I probably damaging Het
Fbxw24 A T 9: 109,609,985 L174Q probably damaging Het
Fryl T A 5: 73,086,560 R91S possibly damaging Het
Gabrd A G 4: 155,388,932 probably null Het
Gtpbp2 A G 17: 46,166,358 D383G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Lipi T A 16: 75,573,955 I125F probably damaging Het
Meig1 T C 2: 3,409,241 E74G probably damaging Het
Mgat4d A T 8: 83,371,706 Q366L probably damaging Het
Mrpl1 A G 5: 96,238,919 N256D possibly damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nphp3 A G 9: 104,030,020 T740A possibly damaging Het
Olfr1090 T A 2: 86,754,120 D206V probably benign Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Pde5a T C 3: 122,729,352 I36T probably benign Het
Pign A T 1: 105,522,060 L914M possibly damaging Het
Ppm1b A G 17: 85,015,419 D382G probably benign Het
Psd3 T C 8: 68,000,761 Y282C probably damaging Het
Ptprt A T 2: 161,927,650 Y432N probably damaging Het
Rbbp6 T C 7: 122,997,311 probably null Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slit3 T C 11: 35,684,048 V1063A probably benign Het
Spdye4a A G 5: 143,225,623 V62A probably benign Het
Ttc6 G A 12: 57,643,050 G509S probably benign Het
Ush2a C T 1: 188,443,431 T1242M probably benign Het
Wwc2 T C 8: 47,831,646 S1155G unknown Het
Zfp551 A T 7: 12,418,641 I55N probably damaging Het
Other mutations in Olfr1080
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Olfr1080 APN 2 86553449 missense probably benign 0.34
IGL02169:Olfr1080 APN 2 86553882 missense probably benign 0.39
IGL02234:Olfr1080 APN 2 86553266 missense probably damaging 1.00
IGL02530:Olfr1080 APN 2 86553880 missense possibly damaging 0.60
R0046:Olfr1080 UTSW 2 86553632 missense probably damaging 1.00
R0360:Olfr1080 UTSW 2 86553779 missense probably damaging 1.00
R0364:Olfr1080 UTSW 2 86553779 missense probably damaging 1.00
R0377:Olfr1080 UTSW 2 86553583 missense probably damaging 1.00
R1496:Olfr1080 UTSW 2 86553752 missense probably damaging 1.00
R1609:Olfr1080 UTSW 2 86553605 missense probably damaging 1.00
R1674:Olfr1080 UTSW 2 86553860 missense probably damaging 0.96
R1816:Olfr1080 UTSW 2 86553667 nonsense probably null
R2870:Olfr1080 UTSW 2 86553584 missense possibly damaging 0.95
R2870:Olfr1080 UTSW 2 86553584 missense possibly damaging 0.95
R4915:Olfr1080 UTSW 2 86554055 missense probably damaging 1.00
R4924:Olfr1080 UTSW 2 86553509 missense probably damaging 1.00
R4987:Olfr1080 UTSW 2 86553235 splice site probably null 0.10
R5774:Olfr1080 UTSW 2 86554007 missense possibly damaging 0.68
R6305:Olfr1080 UTSW 2 86553495 missense possibly damaging 0.91
R6829:Olfr1080 UTSW 2 86553269 nonsense probably null
R7152:Olfr1080 UTSW 2 86553329 missense probably benign 0.14
R7561:Olfr1080 UTSW 2 86553317 missense probably benign 0.45
R7963:Olfr1080 UTSW 2 86553295 missense possibly damaging 0.86
R8031:Olfr1080 UTSW 2 86554103 missense probably damaging 1.00
R8177:Olfr1080 UTSW 2 86553279 missense noncoding transcript
R8349:Olfr1080 UTSW 2 86553636 missense probably benign 0.22
R8449:Olfr1080 UTSW 2 86553636 missense probably benign 0.22
R8490:Olfr1080 UTSW 2 86553683 missense probably benign 0.06
R8787:Olfr1080 UTSW 2 86553953 missense probably damaging 1.00
R8801:Olfr1080 UTSW 2 86553383 missense probably benign 0.22
R8808:Olfr1080 UTSW 2 86553953 missense probably damaging 1.00
R9035:Olfr1080 UTSW 2 86553677 missense probably damaging 0.98
R9301:Olfr1080 UTSW 2 86553474 missense possibly damaging 0.91
Z1088:Olfr1080 UTSW 2 86553966 missense probably benign 0.40
Z1191:Olfr1080 UTSW 2 86554127 start gained probably benign
Predicted Primers PCR Primer
(F):5'- ATAGCGGTCATAGGACATTGC -3'
(R):5'- CCTCTGCTGATGACAGGTCTTC -3'

Sequencing Primer
(F):5'- CGGTCATAGGACATTGCAGACAG -3'
(R):5'- CTGATGACAGGTCTTCTGATAGAG -3'
Posted On 2015-07-06