Incidental Mutation 'R4387:Cd209b'
ID326271
Institutional Source Beutler Lab
Gene Symbol Cd209b
Ensembl Gene ENSMUSG00000065987
Gene NameCD209b antigen
Synonyms1810030I22Rik, SIGNR1, mSIGNR1
MMRRC Submission 041681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R4387 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location3917655-3926844 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3925960 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 67 (L67P)
Ref Sequence ENSEMBL: ENSMUSP00000106643 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084086] [ENSMUST00000111014] [ENSMUST00000171635] [ENSMUST00000188386]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084086
AA Change: L67P

PolyPhen 2 Score 0.948 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000081104
Gene: ENSMUSG00000065987
AA Change: L67P

DomainStartEndE-ValueType
transmembrane domain 53 75 N/A INTRINSIC
low complexity region 91 102 N/A INTRINSIC
CLECT 195 316 3.63e-31 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000111014
AA Change: L67P

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000106643
Gene: ENSMUSG00000065987
AA Change: L67P

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000171635
SMART Domains Protein: ENSMUSP00000126070
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 286 3.63e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188386
SMART Domains Protein: ENSMUSP00000140695
Gene: ENSMUSG00000065987

DomainStartEndE-ValueType
low complexity region 61 72 N/A INTRINSIC
CLECT 165 307 2.43e-23 SMART
Meta Mutation Damage Score 0.4352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutants are more susceptible to S. pneumoniae infection and fail to clear the bacteria from the circulation. Marginal zone and peritoneal macrophages are impaired in recognizing the bacteria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,574 probably null Het
9930021J03Rik A G 19: 29,805,315 probably benign Het
Adprm C T 11: 67,038,193 R324K probably benign Het
AI481877 A T 4: 59,060,915 C953S possibly damaging Het
Calcr T A 6: 3,707,581 N240Y probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cp T C 3: 19,977,202 V601A probably damaging Het
Cyp2a5 A G 7: 26,841,054 D364G probably damaging Het
Eno4 T A 19: 58,953,208 V187D probably benign Het
Fbxl7 C A 15: 26,543,259 S434I probably damaging Het
Fbxw24 A T 9: 109,609,985 L174Q probably damaging Het
Fryl T A 5: 73,086,560 R91S possibly damaging Het
Gabrd A G 4: 155,388,932 probably null Het
Gtpbp2 A G 17: 46,166,358 D383G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Lipi T A 16: 75,573,955 I125F probably damaging Het
Meig1 T C 2: 3,409,241 E74G probably damaging Het
Mgat4d A T 8: 83,371,706 Q366L probably damaging Het
Mrpl1 A G 5: 96,238,919 N256D possibly damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nphp3 A G 9: 104,030,020 T740A possibly damaging Het
Olfr1080 T C 2: 86,553,954 T57A probably damaging Het
Olfr1090 T A 2: 86,754,120 D206V probably benign Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Pde5a T C 3: 122,729,352 I36T probably benign Het
Pign A T 1: 105,522,060 L914M possibly damaging Het
Ppm1b A G 17: 85,015,419 D382G probably benign Het
Psd3 T C 8: 68,000,761 Y282C probably damaging Het
Ptprt A T 2: 161,927,650 Y432N probably damaging Het
Rbbp6 T C 7: 122,997,311 probably null Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slit3 T C 11: 35,684,048 V1063A probably benign Het
Spdye4a A G 5: 143,225,623 V62A probably benign Het
Ttc6 G A 12: 57,643,050 G509S probably benign Het
Ush2a C T 1: 188,443,431 T1242M probably benign Het
Wwc2 T C 8: 47,831,646 S1155G unknown Het
Zfp551 A T 7: 12,418,641 I55N probably damaging Het
Other mutations in Cd209b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Cd209b APN 8 3919945 splice site probably benign
IGL01596:Cd209b APN 8 3918744 missense probably damaging 1.00
IGL03211:Cd209b APN 8 3918830 splice site probably benign
R1434:Cd209b UTSW 8 3923367 missense possibly damaging 0.49
R4127:Cd209b UTSW 8 3918714 missense probably damaging 1.00
R4388:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4389:Cd209b UTSW 8 3925960 missense probably damaging 0.99
R4708:Cd209b UTSW 8 3924215 missense probably damaging 0.99
R4710:Cd209b UTSW 8 3924215 missense probably damaging 0.99
R4911:Cd209b UTSW 8 3926640 critical splice acceptor site probably null
R5454:Cd209b UTSW 8 3925396 missense probably damaging 0.98
R5814:Cd209b UTSW 8 3923348 missense probably damaging 0.99
R5853:Cd209b UTSW 8 3926549 splice site probably null
R5867:Cd209b UTSW 8 3924246 missense possibly damaging 0.62
R5996:Cd209b UTSW 8 3918688 missense probably benign 0.39
R7020:Cd209b UTSW 8 3918783 missense probably damaging 0.99
R7187:Cd209b UTSW 8 3926638 missense probably benign
R7695:Cd209b UTSW 8 3926005 missense probably benign
R7712:Cd209b UTSW 8 3923299 missense possibly damaging 0.83
R7975:Cd209b UTSW 8 3925948 missense probably benign 0.41
R8309:Cd209b UTSW 8 3926559 nonsense probably null
R8317:Cd209b UTSW 8 3922018 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTGCCACTCAGAAGATGCTG -3'
(R):5'- CTTTGAGAAGATTGAGGCCAGG -3'

Sequencing Primer
(F):5'- TGAATCCAGGATCCACCCATG -3'
(R):5'- GGGAACAAAACCATGGCCCATG -3'
Posted On2015-07-06