Incidental Mutation 'R4387:Fbxw24'
ID326276
Institutional Source Beutler Lab
Gene Symbol Fbxw24
Ensembl Gene ENSMUSG00000062275
Gene NameF-box and WD-40 domain protein 24
SynonymsGm5162
MMRRC Submission 041681-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R4387 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109601116-109626057 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109609985 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 174 (L174Q)
Ref Sequence ENSEMBL: ENSMUSP00000073617 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073962]
Predicted Effect probably damaging
Transcript: ENSMUST00000073962
AA Change: L174Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000073617
Gene: ENSMUSG00000062275
AA Change: L174Q

DomainStartEndE-ValueType
FBOX 8 45 3.25e-4 SMART
SCOP:d1gxra_ 87 227 8e-7 SMART
Blast:WD40 137 176 1e-6 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,574 probably null Het
9930021J03Rik A G 19: 29,805,315 probably benign Het
Adprm C T 11: 67,038,193 R324K probably benign Het
AI481877 A T 4: 59,060,915 C953S possibly damaging Het
Calcr T A 6: 3,707,581 N240Y probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cp T C 3: 19,977,202 V601A probably damaging Het
Cyp2a5 A G 7: 26,841,054 D364G probably damaging Het
Eno4 T A 19: 58,953,208 V187D probably benign Het
Fbxl7 C A 15: 26,543,259 S434I probably damaging Het
Fryl T A 5: 73,086,560 R91S possibly damaging Het
Gabrd A G 4: 155,388,932 probably null Het
Gtpbp2 A G 17: 46,166,358 D383G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Lipi T A 16: 75,573,955 I125F probably damaging Het
Meig1 T C 2: 3,409,241 E74G probably damaging Het
Mgat4d A T 8: 83,371,706 Q366L probably damaging Het
Mrpl1 A G 5: 96,238,919 N256D possibly damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nphp3 A G 9: 104,030,020 T740A possibly damaging Het
Olfr1080 T C 2: 86,553,954 T57A probably damaging Het
Olfr1090 T A 2: 86,754,120 D206V probably benign Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Pde5a T C 3: 122,729,352 I36T probably benign Het
Pign A T 1: 105,522,060 L914M possibly damaging Het
Ppm1b A G 17: 85,015,419 D382G probably benign Het
Psd3 T C 8: 68,000,761 Y282C probably damaging Het
Ptprt A T 2: 161,927,650 Y432N probably damaging Het
Rbbp6 T C 7: 122,997,311 probably null Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slit3 T C 11: 35,684,048 V1063A probably benign Het
Spdye4a A G 5: 143,225,623 V62A probably benign Het
Ttc6 G A 12: 57,643,050 G509S probably benign Het
Ush2a C T 1: 188,443,431 T1242M probably benign Het
Wwc2 T C 8: 47,831,646 S1155G unknown Het
Zfp551 A T 7: 12,418,641 I55N probably damaging Het
Other mutations in Fbxw24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01093:Fbxw24 APN 9 109604973 missense probably benign 0.00
IGL01373:Fbxw24 APN 9 109623633 missense probably damaging 0.98
IGL01996:Fbxw24 APN 9 109605372 missense possibly damaging 0.84
IGL02179:Fbxw24 APN 9 109609905 nonsense probably null
IGL02718:Fbxw24 APN 9 109624790 missense possibly damaging 0.55
IGL02936:Fbxw24 APN 9 109624958 splice site probably null
IGL03010:Fbxw24 APN 9 109623610 missense probably benign 0.07
IGL03350:Fbxw24 APN 9 109607013 missense probably damaging 1.00
IGL03402:Fbxw24 APN 9 109601248 missense probably damaging 1.00
R0140:Fbxw24 UTSW 9 109605414 missense possibly damaging 0.73
R0718:Fbxw24 UTSW 9 109623509 splice site probably benign
R1166:Fbxw24 UTSW 9 109606998 missense probably benign 0.00
R1550:Fbxw24 UTSW 9 109607044 missense probably benign 0.00
R1950:Fbxw24 UTSW 9 109605413 missense probably benign 0.02
R1986:Fbxw24 UTSW 9 109607056 missense probably damaging 0.97
R2244:Fbxw24 UTSW 9 109605049 missense possibly damaging 0.66
R3683:Fbxw24 UTSW 9 109608042 missense possibly damaging 0.51
R4324:Fbxw24 UTSW 9 109604945 critical splice donor site probably null
R4409:Fbxw24 UTSW 9 109608188 missense probably damaging 1.00
R4410:Fbxw24 UTSW 9 109608188 missense probably damaging 1.00
R4803:Fbxw24 UTSW 9 109624842 missense probably benign 0.02
R5571:Fbxw24 UTSW 9 109606998 missense probably benign 0.00
R6042:Fbxw24 UTSW 9 109607011 missense probably benign 0.09
R6523:Fbxw24 UTSW 9 109604980 nonsense probably null
R6799:Fbxw24 UTSW 9 109624930 missense probably damaging 1.00
R7122:Fbxw24 UTSW 9 109601260 missense probably benign 0.03
R7239:Fbxw24 UTSW 9 109605530 missense possibly damaging 0.71
R7405:Fbxw24 UTSW 9 109607068 missense possibly damaging 0.46
R7705:Fbxw24 UTSW 9 109608448 intron probably null
Predicted Primers PCR Primer
(F):5'- CAGCATTTGCAGAGACTCCAAG -3'
(R):5'- CTTCCAAATAAAACTGGTGGGTG -3'

Sequencing Primer
(F):5'- TCCAAAGGTCCTGAGTTCAAGTC -3'
(R):5'- CTGGTGGGTGAAAGCAGCTG -3'
Posted On2015-07-06