Incidental Mutation 'R0013:Arap2'
ID32628
Institutional Source Beutler Lab
Gene Symbol Arap2
Ensembl Gene ENSMUSG00000037999
Gene NameArfGAP with RhoGAP domain, ankyrin repeat and PH domain 2
SynonymsCentd1
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0013 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location62602445-62766159 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 62683484 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Phenylalanine at position 680 (L680F)
Ref Sequence ENSEMBL: ENSMUSP00000075924 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076623]
Predicted Effect probably damaging
Transcript: ENSMUST00000076623
AA Change: L680F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075924
Gene: ENSMUSG00000037999
AA Change: L680F

DomainStartEndE-ValueType
SAM 3 70 3.69e-7 SMART
low complexity region 222 233 N/A INTRINSIC
PH 481 574 6.45e-17 SMART
PH 586 679 9.05e-12 SMART
ArfGap 684 805 9.2e-33 SMART
PH 891 1003 1.51e-8 SMART
PH 1013 1112 9.21e-4 SMART
RhoGAP 1124 1300 1.36e-50 SMART
Pfam:RA 1325 1416 2.1e-7 PFAM
PH 1429 1533 2.68e-14 SMART
coiled coil region 1561 1590 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201373
Meta Mutation Damage Score 0.1340 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ARF-GAP, RHO-GAP, ankyrin repeat, RAS-associating, and pleckstrin homology domains. The protein is a phosphatidylinositol (3,4,5)-trisphosphate-dependent Arf6 GAP that binds RhoA-GTP, but it lacks the predicted catalytic arginine in the RHO-GAP domain and does not have RHO-GAP activity. The protein associates with focal adhesions and functions downstream of RhoA to regulate focal adhesion dynamics. [provided by RefSeq, Sep 2008]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Arap2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00481:Arap2 APN 5 62635962 missense probably damaging 1.00
IGL00642:Arap2 APN 5 62733058 nonsense probably null
IGL00705:Arap2 APN 5 62678023 missense probably damaging 1.00
IGL00942:Arap2 APN 5 62698389 nonsense probably null
IGL01069:Arap2 APN 5 62649856 missense probably benign
IGL01601:Arap2 APN 5 62641342 missense probably damaging 1.00
IGL01986:Arap2 APN 5 62621922 missense probably damaging 1.00
IGL02032:Arap2 APN 5 62670997 missense probably damaging 0.99
IGL02262:Arap2 APN 5 62642841 missense probably damaging 1.00
IGL02331:Arap2 APN 5 62649682 splice site probably benign
IGL02527:Arap2 APN 5 62749307 missense probably benign
IGL02803:Arap2 APN 5 62749109 missense probably benign
IGL02864:Arap2 APN 5 62677965 missense probably damaging 1.00
IGL03078:Arap2 APN 5 62733065 splice site probably benign
IGL03154:Arap2 APN 5 62642925 missense probably damaging 1.00
IGL03213:Arap2 APN 5 62749095 missense probably benign 0.00
IGL03279:Arap2 APN 5 62621910 missense probably damaging 1.00
IGL03288:Arap2 APN 5 62604616 missense probably benign 0.00
PIT4354001:Arap2 UTSW 5 62654049 missense probably damaging 1.00
R0012:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0013:Arap2 UTSW 5 62683484 missense probably damaging 1.00
R0166:Arap2 UTSW 5 62676018 missense probably damaging 1.00
R0472:Arap2 UTSW 5 62706659 missense probably damaging 1.00
R0506:Arap2 UTSW 5 62606131 missense possibly damaging 0.87
R0551:Arap2 UTSW 5 62641323 splice site probably null
R0607:Arap2 UTSW 5 62606131 missense possibly damaging 0.87
R0617:Arap2 UTSW 5 62649907 splice site probably benign
R0975:Arap2 UTSW 5 62730886 splice site probably benign
R0976:Arap2 UTSW 5 62649884 missense probably damaging 1.00
R1164:Arap2 UTSW 5 62683477 missense probably damaging 1.00
R1268:Arap2 UTSW 5 62730621 missense probably benign 0.00
R1480:Arap2 UTSW 5 62669129 nonsense probably null
R1502:Arap2 UTSW 5 62604404 missense probably benign 0.00
R1543:Arap2 UTSW 5 62606155 nonsense probably null
R1865:Arap2 UTSW 5 62698263 missense probably damaging 0.97
R1962:Arap2 UTSW 5 62676664 missense possibly damaging 0.82
R2040:Arap2 UTSW 5 62748916 missense probably damaging 0.99
R2118:Arap2 UTSW 5 62706685 missense probably damaging 1.00
R2131:Arap2 UTSW 5 62677958 missense probably damaging 1.00
R2201:Arap2 UTSW 5 62706685 missense probably damaging 1.00
R2215:Arap2 UTSW 5 62677176 missense probably damaging 1.00
R3027:Arap2 UTSW 5 62669897 missense probably damaging 1.00
R3053:Arap2 UTSW 5 62748857 missense probably benign 0.35
R3975:Arap2 UTSW 5 62748894 missense possibly damaging 0.87
R4272:Arap2 UTSW 5 62670979 missense possibly damaging 0.63
R4273:Arap2 UTSW 5 62670979 missense possibly damaging 0.63
R4326:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4327:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4328:Arap2 UTSW 5 62621863 missense possibly damaging 0.50
R4451:Arap2 UTSW 5 62749170 missense probably benign 0.06
R4659:Arap2 UTSW 5 62654126 missense possibly damaging 0.94
R4665:Arap2 UTSW 5 62669969 missense possibly damaging 0.95
R4715:Arap2 UTSW 5 62749094 missense probably benign 0.43
R4808:Arap2 UTSW 5 62730641 missense probably benign 0.23
R4941:Arap2 UTSW 5 62749478 missense probably benign 0.20
R4983:Arap2 UTSW 5 62676525 missense probably damaging 0.98
R5095:Arap2 UTSW 5 62654049 missense probably damaging 1.00
R5156:Arap2 UTSW 5 62669181 nonsense probably null
R5201:Arap2 UTSW 5 62683489 missense probably damaging 1.00
R5346:Arap2 UTSW 5 62714746 missense probably benign 0.39
R5359:Arap2 UTSW 5 62683419 nonsense probably null
R5426:Arap2 UTSW 5 62642816 missense probably benign 0.02
R5503:Arap2 UTSW 5 62630186 missense probably damaging 1.00
R5605:Arap2 UTSW 5 62615067 missense possibly damaging 0.47
R5764:Arap2 UTSW 5 62642854 missense probably damaging 1.00
R5813:Arap2 UTSW 5 62677163 missense probably damaging 1.00
R5846:Arap2 UTSW 5 62649773 missense probably damaging 1.00
R6084:Arap2 UTSW 5 62670954 missense possibly damaging 0.89
R6173:Arap2 UTSW 5 62749622 missense probably damaging 1.00
R6175:Arap2 UTSW 5 62714731 critical splice donor site probably null
R6249:Arap2 UTSW 5 62646193 missense probably damaging 0.99
R6386:Arap2 UTSW 5 62604522 missense possibly damaging 0.89
R6424:Arap2 UTSW 5 62683364 missense probably damaging 1.00
R6744:Arap2 UTSW 5 62748938 missense probably damaging 1.00
R6766:Arap2 UTSW 5 62677100 critical splice donor site probably null
R6990:Arap2 UTSW 5 62676517 missense probably damaging 0.96
R7067:Arap2 UTSW 5 62654044 critical splice donor site probably null
R7098:Arap2 UTSW 5 62675950 critical splice donor site probably null
R7107:Arap2 UTSW 5 62606208 missense probably damaging 0.98
R7156:Arap2 UTSW 5 62604571 missense probably damaging 1.00
R7174:Arap2 UTSW 5 62604278 missense probably benign
R7187:Arap2 UTSW 5 62669053 missense probably damaging 0.99
R7197:Arap2 UTSW 5 62641386 missense possibly damaging 0.89
R7214:Arap2 UTSW 5 62749338 missense probably benign 0.00
R7317:Arap2 UTSW 5 62649724 missense probably damaging 1.00
R7392:Arap2 UTSW 5 62698385 missense possibly damaging 0.54
R7438:Arap2 UTSW 5 62749475 missense probably damaging 0.99
R7452:Arap2 UTSW 5 62676549 missense probably benign 0.00
R7495:Arap2 UTSW 5 62676550 missense possibly damaging 0.78
R7796:Arap2 UTSW 5 62730762 missense probably damaging 1.00
R7936:Arap2 UTSW 5 62730705 missense probably damaging 0.96
R8116:Arap2 UTSW 5 62730611 missense probably benign 0.00
R8172:Arap2 UTSW 5 62621981 splice site probably null
R8277:Arap2 UTSW 5 62613992 critical splice donor site probably null
R8369:Arap2 UTSW 5 62604326 nonsense probably null
R8398:Arap2 UTSW 5 62748909 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAATCTGCCACCAAGCAGAGATGAG -3'
(R):5'- TATGTGGACAGGGCCATAAGCAGC -3'

Sequencing Primer
(F):5'- GAGCATAGCTCATCACTAATTACCTG -3'
(R):5'- CTGCCCAGCAGGCATAATTTTAG -3'
Posted On2013-05-09