Incidental Mutation 'R4387:Fbxl7'
ID326283
Institutional Source Beutler Lab
Gene Symbol Fbxl7
Ensembl Gene ENSMUSG00000043556
Gene NameF-box and leucine-rich repeat protein 7
SynonymsD230018M15Rik, Fbl6, FBL7
MMRRC Submission 041681-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4387 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location26540459-26895580 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 26543259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Isoleucine at position 434 (S434I)
Ref Sequence ENSEMBL: ENSMUSP00000061305 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059204]
Predicted Effect probably damaging
Transcript: ENSMUST00000059204
AA Change: S434I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061305
Gene: ENSMUSG00000043556
AA Change: S434I

DomainStartEndE-ValueType
low complexity region 16 26 N/A INTRINSIC
low complexity region 73 79 N/A INTRINSIC
FBOX 117 157 2.7e-11 SMART
LRR_CC 185 210 2e-7 SMART
LRR_CC 211 236 2.1e-7 SMART
LRR 237 262 6.3e-7 SMART
LRR 271 296 3.5e-1 SMART
LRR_CC 297 322 1.7e-8 SMART
LRR_CC 323 348 5.5e-8 SMART
LRR_CC 349 374 6.5e-8 SMART
LRR_CC 375 400 9.1e-10 SMART
LRR_CC 401 426 2.1e-8 SMART
LRR_CC 427 452 1.8e-7 SMART
Blast:LRR 453 477 2e-7 BLAST
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by a 42-48 amino acid motif, the F-box, which binds to the S-phase kinase-associated protein 1 (Skp1) protein. The F-box proteins constitute one of the four subunits of E3 ubiquitin protein ligases called SCFs (SKP1-Cul1-F-box), which play a role in phosphorylation-dependent ubiquitination of proteins. The F-box proteins are divided into 3 subfamilies based on the other domain in the protein: F-box proteins that also have a WD-40 domain (Fbws subfamily), F-box proteins that also have leucine-rich repeats (Fbls subfamily) and F-box proteins that contain other motifs or lack known protein-interaction domains (Fbxs subfamily). The protein encoded by this gene belongs to the Fbls subfamily. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,574 probably null Het
9930021J03Rik A G 19: 29,805,315 probably benign Het
Adprm C T 11: 67,038,193 R324K probably benign Het
AI481877 A T 4: 59,060,915 C953S possibly damaging Het
Calcr T A 6: 3,707,581 N240Y probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cp T C 3: 19,977,202 V601A probably damaging Het
Cyp2a5 A G 7: 26,841,054 D364G probably damaging Het
Eno4 T A 19: 58,953,208 V187D probably benign Het
Fbxw24 A T 9: 109,609,985 L174Q probably damaging Het
Fryl T A 5: 73,086,560 R91S possibly damaging Het
Gabrd A G 4: 155,388,932 probably null Het
Gtpbp2 A G 17: 46,166,358 D383G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Lipi T A 16: 75,573,955 I125F probably damaging Het
Meig1 T C 2: 3,409,241 E74G probably damaging Het
Mgat4d A T 8: 83,371,706 Q366L probably damaging Het
Mrpl1 A G 5: 96,238,919 N256D possibly damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nphp3 A G 9: 104,030,020 T740A possibly damaging Het
Olfr1080 T C 2: 86,553,954 T57A probably damaging Het
Olfr1090 T A 2: 86,754,120 D206V probably benign Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Pde5a T C 3: 122,729,352 I36T probably benign Het
Pign A T 1: 105,522,060 L914M possibly damaging Het
Ppm1b A G 17: 85,015,419 D382G probably benign Het
Psd3 T C 8: 68,000,761 Y282C probably damaging Het
Ptprt A T 2: 161,927,650 Y432N probably damaging Het
Rbbp6 T C 7: 122,997,311 probably null Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slit3 T C 11: 35,684,048 V1063A probably benign Het
Spdye4a A G 5: 143,225,623 V62A probably benign Het
Ttc6 G A 12: 57,643,050 G509S probably benign Het
Ush2a C T 1: 188,443,431 T1242M probably benign Het
Wwc2 T C 8: 47,831,646 S1155G unknown Het
Zfp551 A T 7: 12,418,641 I55N probably damaging Het
Other mutations in Fbxl7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01979:Fbxl7 APN 15 26789563 missense probably damaging 0.98
R0482:Fbxl7 UTSW 15 26543546 missense probably benign 0.06
R1734:Fbxl7 UTSW 15 26543649 missense probably damaging 1.00
R1826:Fbxl7 UTSW 15 26552765 missense possibly damaging 0.59
R1859:Fbxl7 UTSW 15 26543193 missense probably damaging 1.00
R2410:Fbxl7 UTSW 15 26895025 missense possibly damaging 0.79
R3703:Fbxl7 UTSW 15 26543755 missense probably damaging 1.00
R3704:Fbxl7 UTSW 15 26543755 missense probably damaging 1.00
R4025:Fbxl7 UTSW 15 26552819 missense probably benign 0.20
R5055:Fbxl7 UTSW 15 26552936 missense probably damaging 0.98
R5070:Fbxl7 UTSW 15 26789554 missense probably benign 0.15
R5180:Fbxl7 UTSW 15 26543421 missense probably damaging 1.00
R5260:Fbxl7 UTSW 15 26543499 missense probably damaging 1.00
R5720:Fbxl7 UTSW 15 26552893 missense probably damaging 0.98
R6256:Fbxl7 UTSW 15 26553002 missense probably benign 0.16
R6874:Fbxl7 UTSW 15 26552942 missense probably benign
R7143:Fbxl7 UTSW 15 26543158 missense probably benign
R7941:Fbxl7 UTSW 15 26543613 missense probably damaging 1.00
R8848:Fbxl7 UTSW 15 26552816 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGAGCTGTCCCTTCAGAAGAAAG -3'
(R):5'- CATCACGGATGTGGGCATTC -3'

Sequencing Primer
(F):5'- TCCCTTCAGAAGAAAGCGGGG -3'
(R):5'- CGTTATGTGGCTAAATACTGCAGC -3'
Posted On2015-07-06