Incidental Mutation 'R4387:Recql4'
ID326285
Institutional Source Beutler Lab
Gene Symbol Recql4
Ensembl Gene ENSMUSG00000033762
Gene NameRecQ protein-like 4
Synonyms
MMRRC Submission 041681-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4387 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location76703553-76710548 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76705958 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 659 (S659P)
Ref Sequence ENSEMBL: ENSMUSP00000155694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019224] [ENSMUST00000036423] [ENSMUST00000036852] [ENSMUST00000127208] [ENSMUST00000136840] [ENSMUST00000137649] [ENSMUST00000142610] [ENSMUST00000155225] [ENSMUST00000155735] [ENSMUST00000230544] [ENSMUST00000230724]
Predicted Effect probably benign
Transcript: ENSMUST00000019224
SMART Domains Protein: ENSMUSP00000019224
Gene: ENSMUSG00000019080

DomainStartEndE-ValueType
Pfam:MFS_1 8 373 3e-16 PFAM
transmembrane domain 388 407 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036423
SMART Domains Protein: ENSMUSP00000049466
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036852
AA Change: S752P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000044363
Gene: ENSMUSG00000033762
AA Change: S752P

DomainStartEndE-ValueType
Pfam:Drc1-Sld2 4 132 2.8e-14 PFAM
low complexity region 169 187 N/A INTRINSIC
low complexity region 368 379 N/A INTRINSIC
ZnF_C2HC 394 410 5.67e-5 SMART
DEXDc 494 701 5.86e-28 SMART
HELICc 736 831 1.48e-24 SMART
Blast:DEXDc 902 1117 3e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127208
SMART Domains Protein: ENSMUSP00000114921
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000136840
SMART Domains Protein: ENSMUSP00000119670
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000137649
SMART Domains Protein: ENSMUSP00000121982
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138132
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142506
Predicted Effect probably benign
Transcript: ENSMUST00000142610
SMART Domains Protein: ENSMUSP00000117780
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154531
Predicted Effect probably benign
Transcript: ENSMUST00000155225
Predicted Effect probably benign
Transcript: ENSMUST00000155735
SMART Domains Protein: ENSMUSP00000115446
Gene: ENSMUSG00000033728

DomainStartEndE-ValueType
low complexity region 23 35 N/A INTRINSIC
low complexity region 55 66 N/A INTRINSIC
SCOP:d1a4ya_ 222 413 2e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229018
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229098
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229360
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230468
Predicted Effect probably benign
Transcript: ENSMUST00000230544
AA Change: S659P

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000230724
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a DNA helicase that belongs to the RecQ helicase family. DNA helicases unwind double-stranded DNA into single-stranded DNAs and may modulate chromosome segregation. This gene is predominantly expressed in thymus and testis. Mutations in this gene are associated with Rothmund-Thomson, RAPADILINO and Baller-Gerold syndromes. [provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous loss of exons 5-8 causes embryonic death. Deletion of exon 13 causes neo- and postnatal lethality, stunted growth, skin, hair and bone defects, tissue hypoplasia and tooth dysgenesis. Mice lacking exons 9-13 show palate and limb defects, aneuploidy, poikiloderma and cancer predisposition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,574 probably null Het
9930021J03Rik A G 19: 29,805,315 probably benign Het
Adprm C T 11: 67,038,193 R324K probably benign Het
AI481877 A T 4: 59,060,915 C953S possibly damaging Het
Calcr T A 6: 3,707,581 N240Y probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cp T C 3: 19,977,202 V601A probably damaging Het
Cyp2a5 A G 7: 26,841,054 D364G probably damaging Het
Eno4 T A 19: 58,953,208 V187D probably benign Het
Fbxl7 C A 15: 26,543,259 S434I probably damaging Het
Fbxw24 A T 9: 109,609,985 L174Q probably damaging Het
Fryl T A 5: 73,086,560 R91S possibly damaging Het
Gabrd A G 4: 155,388,932 probably null Het
Gtpbp2 A G 17: 46,166,358 D383G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Lipi T A 16: 75,573,955 I125F probably damaging Het
Meig1 T C 2: 3,409,241 E74G probably damaging Het
Mgat4d A T 8: 83,371,706 Q366L probably damaging Het
Mrpl1 A G 5: 96,238,919 N256D possibly damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nphp3 A G 9: 104,030,020 T740A possibly damaging Het
Olfr1080 T C 2: 86,553,954 T57A probably damaging Het
Olfr1090 T A 2: 86,754,120 D206V probably benign Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Pde5a T C 3: 122,729,352 I36T probably benign Het
Pign A T 1: 105,522,060 L914M possibly damaging Het
Ppm1b A G 17: 85,015,419 D382G probably benign Het
Psd3 T C 8: 68,000,761 Y282C probably damaging Het
Ptprt A T 2: 161,927,650 Y432N probably damaging Het
Rbbp6 T C 7: 122,997,311 probably null Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slit3 T C 11: 35,684,048 V1063A probably benign Het
Spdye4a A G 5: 143,225,623 V62A probably benign Het
Ttc6 G A 12: 57,643,050 G509S probably benign Het
Ush2a C T 1: 188,443,431 T1242M probably benign Het
Wwc2 T C 8: 47,831,646 S1155G unknown Het
Zfp551 A T 7: 12,418,641 I55N probably damaging Het
Other mutations in Recql4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00088:Recql4 APN 15 76707336 missense possibly damaging 0.52
IGL01287:Recql4 APN 15 76709912 splice site probably benign
IGL01470:Recql4 APN 15 76708944 missense probably benign 0.40
IGL01809:Recql4 APN 15 76708870 nonsense probably null
IGL02094:Recql4 APN 15 76709517 missense probably benign 0.01
IGL02303:Recql4 APN 15 76708571 missense possibly damaging 0.64
IGL02702:Recql4 APN 15 76707285 missense probably damaging 1.00
IGL03086:Recql4 APN 15 76706268 missense probably benign 0.30
IGL03162:Recql4 APN 15 76706096 splice site probably null
ANU74:Recql4 UTSW 15 76705757 missense possibly damaging 0.47
F5770:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
R0688:Recql4 UTSW 15 76709809 unclassified probably null
R1171:Recql4 UTSW 15 76704039 missense possibly damaging 0.94
R1348:Recql4 UTSW 15 76709211 missense probably benign 0.01
R1487:Recql4 UTSW 15 76708983 missense probably benign 0.11
R1547:Recql4 UTSW 15 76706311 missense probably damaging 0.99
R1917:Recql4 UTSW 15 76703837 nonsense probably null
R3813:Recql4 UTSW 15 76704494 missense possibly damaging 0.67
R4066:Recql4 UTSW 15 76705827 missense probably damaging 1.00
R4363:Recql4 UTSW 15 76706044 missense probably benign 0.07
R4388:Recql4 UTSW 15 76705958 missense probably benign 0.00
R4700:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4701:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R4923:Recql4 UTSW 15 76710181 missense probably damaging 1.00
R5075:Recql4 UTSW 15 76709544 missense probably damaging 1.00
R5103:Recql4 UTSW 15 76706756 missense probably damaging 1.00
R5226:Recql4 UTSW 15 76710129 missense probably benign
R5500:Recql4 UTSW 15 76705578 intron probably benign
R5547:Recql4 UTSW 15 76705794 nonsense probably null
R5824:Recql4 UTSW 15 76708585 missense probably damaging 1.00
R5976:Recql4 UTSW 15 76709424 missense probably benign 0.01
R6086:Recql4 UTSW 15 76704587 missense probably damaging 0.96
R6756:Recql4 UTSW 15 76704859 missense probably benign 0.00
R7075:Recql4 UTSW 15 76706424 missense possibly damaging 0.95
R7086:Recql4 UTSW 15 76705553 missense unknown
R7449:Recql4 UTSW 15 76705565 missense unknown
R7653:Recql4 UTSW 15 76703782 missense probably benign 0.01
V7580:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7581:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
V7583:Recql4 UTSW 15 76706169 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- CGCATGAAGGCCTGTTGTAC -3'
(R):5'- AGACTCAGACCAGGTATGTAAGTAC -3'

Sequencing Primer
(F):5'- CATGAAGGCCTGTTGTACTCGTC -3'
(R):5'- GGAACCTGTCAGAAGCCC -3'
Posted On2015-07-06