Incidental Mutation 'R0013:Antxr2'
ID32629
Institutional Source Beutler Lab
Gene Symbol Antxr2
Ensembl Gene ENSMUSG00000029338
Gene Nameanthrax toxin receptor 2
Synonyms2310046B19Rik, CMG2, CMG-2, cI-35
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.128) question?
Stock #R0013 (G1)
Quality Score84
Status Validated
Chromosome5
Chromosomal Location97882783-98031043 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97979985 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 229 (V229A)
Ref Sequence ENSEMBL: ENSMUSP00000142605 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031281] [ENSMUST00000199088]
Predicted Effect probably damaging
Transcript: ENSMUST00000031281
AA Change: V229A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000031281
Gene: ENSMUSG00000029338
AA Change: V229A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
VWA 42 214 2.86e-18 SMART
Pfam:Anth_Ig 215 317 4e-38 PFAM
transmembrane domain 319 341 N/A INTRINSIC
low complexity region 352 369 N/A INTRINSIC
Pfam:Ant_C 394 485 7.4e-46 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000199088
AA Change: V229A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142605
Gene: ENSMUSG00000029338
AA Change: V229A

DomainStartEndE-ValueType
signal peptide 1 31 N/A INTRINSIC
VWA 42 214 1.7e-20 SMART
transmembrane domain 319 341 N/A INTRINSIC
low complexity region 352 369 N/A INTRINSIC
Pfam:Ant_C 394 483 1.6e-41 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202736
Meta Mutation Damage Score 0.2926 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a receptor for anthrax toxin. The protein binds to collagen IV and laminin, suggesting that it may be involved in extracellular matrix adhesion. Mutations in this gene cause juvenile hyaline fibromatosis and infantile systemic hyalinosis. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for null mutations display female infertility. Mice homozygous for one allele are highly resistant to Bacillus anthracis or anthrax toxin induced lethality. Young mice homozygous for a second allele display pregnancy-related premature death and failure of parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mboat7 A G 7: 3,683,822 S340P probably damaging Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Antxr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00566:Antxr2 APN 5 97886607 splice site probably benign
IGL00661:Antxr2 APN 5 98004296 missense probably benign 0.26
IGL01105:Antxr2 APN 5 98004943 splice site probably benign
IGL01472:Antxr2 APN 5 98027499 missense probably benign 0.00
IGL01719:Antxr2 APN 5 97948273 missense possibly damaging 0.82
IGL02184:Antxr2 APN 5 97977595 splice site probably null
IGL02199:Antxr2 APN 5 97977595 splice site probably null
IGL02250:Antxr2 APN 5 97977595 splice site probably null
IGL02251:Antxr2 APN 5 97977595 splice site probably null
IGL02368:Antxr2 APN 5 97949198 missense probably damaging 1.00
IGL02447:Antxr2 APN 5 98030408 missense possibly damaging 0.61
IGL02740:Antxr2 APN 5 98030392 splice site probably benign
IGL02850:Antxr2 APN 5 98004078 missense probably damaging 1.00
IGL02867:Antxr2 APN 5 97977650 missense probably benign 0.00
IGL02889:Antxr2 APN 5 97977650 missense probably benign 0.00
R0040:Antxr2 UTSW 5 97938425 missense possibly damaging 0.74
R0040:Antxr2 UTSW 5 97938425 missense possibly damaging 0.74
R0069:Antxr2 UTSW 5 97948250 missense possibly damaging 0.95
R0184:Antxr2 UTSW 5 97980030 missense probably damaging 1.00
R0367:Antxr2 UTSW 5 98029596 missense probably benign 0.01
R0638:Antxr2 UTSW 5 97960637 nonsense probably null
R0732:Antxr2 UTSW 5 97960708 splice site probably null
R1255:Antxr2 UTSW 5 97975372 missense probably benign 0.39
R1471:Antxr2 UTSW 5 97975340 missense possibly damaging 0.88
R1520:Antxr2 UTSW 5 97960692 missense probably benign 0.38
R1660:Antxr2 UTSW 5 97975350 nonsense probably null
R1870:Antxr2 UTSW 5 98030438 missense probably damaging 1.00
R2969:Antxr2 UTSW 5 98030416 nonsense probably null
R3547:Antxr2 UTSW 5 97977657 missense probably benign 0.09
R4237:Antxr2 UTSW 5 97938407 missense probably damaging 1.00
R4660:Antxr2 UTSW 5 98004054 critical splice donor site probably null
R4702:Antxr2 UTSW 5 97949169 critical splice donor site probably null
R4893:Antxr2 UTSW 5 98004072 missense probably damaging 1.00
R4997:Antxr2 UTSW 5 97977694 missense probably benign 0.04
R5388:Antxr2 UTSW 5 97977599 critical splice donor site probably null
R5604:Antxr2 UTSW 5 97948310 missense probably damaging 0.98
R6093:Antxr2 UTSW 5 98030460 missense probably damaging 0.99
R6118:Antxr2 UTSW 5 97949201 missense probably damaging 1.00
R6130:Antxr2 UTSW 5 98004272 missense possibly damaging 0.89
R6139:Antxr2 UTSW 5 97977706 splice site probably null
R6992:Antxr2 UTSW 5 97960705 missense probably benign 0.09
R8127:Antxr2 UTSW 5 97980017 nonsense probably null
R8267:Antxr2 UTSW 5 97965762 critical splice acceptor site probably null
R8301:Antxr2 UTSW 5 97977679 missense probably benign 0.20
R8324:Antxr2 UTSW 5 97938509 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCATTTCCCTATGAGCCTGGAGC -3'
(R):5'- TGTTAGACCCTGCGACAACACAAG -3'

Sequencing Primer
(F):5'- CCAGGTCATTAGAGCATAGAGC -3'
(R):5'- CTCAATGGGTAGTGGTGAATTGAC -3'
Posted On2013-05-09