Incidental Mutation 'R4388:Gm12666'
ID326296
Institutional Source Beutler Lab
Gene Symbol Gm12666
Ensembl Gene ENSMUSG00000066107
Gene Namepredicted gene 12666
Synonyms
MMRRC Submission 041125-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.331) question?
Stock #R4388 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location92190744-92191749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92191114 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 157 (S157T)
Ref Sequence ENSEMBL: ENSMUSP00000122212 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000123179]
Predicted Effect probably benign
Transcript: ENSMUST00000123179
AA Change: S157T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000122212
Gene: ENSMUSG00000066107
AA Change: S157T

DomainStartEndE-ValueType
RRM 3 73 9.8e-9 SMART
low complexity region 87 103 N/A INTRINSIC
low complexity region 134 153 N/A INTRINSIC
low complexity region 179 188 N/A INTRINSIC
low complexity region 228 246 N/A INTRINSIC
Meta Mutation Damage Score 0.0599 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 86% (31/36)
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,574 probably null Het
Adgrv1 T C 13: 81,581,709 T218A probably damaging Het
Aldh1l2 T C 10: 83,513,622 D254G probably damaging Het
Arpc4 A G 6: 113,385,497 D36G probably damaging Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cldn20 G A 17: 3,533,210 M219I probably benign Het
Dmxl2 G A 9: 54,396,267 P2308S probably damaging Het
Fancd2 A G 6: 113,556,368 I549V probably damaging Het
Galnt2 T C 8: 124,295,453 probably null Het
Galnt9 A G 5: 110,588,391 D191G probably damaging Het
Hgf T A 5: 16,614,943 H557Q probably benign Het
Ifna12 T C 4: 88,603,109 D67G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Itih1 A G 14: 30,941,555 V164A possibly damaging Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Kmt2b A C 7: 30,588,590 probably benign Het
Kmt2d C T 15: 98,853,626 probably benign Het
Kng1 T A 16: 23,079,318 H489Q possibly damaging Het
Map4k5 C A 12: 69,845,809 M115I probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Naca T C 10: 128,044,792 S1898P probably damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Pex26 A G 6: 121,184,392 D43G probably damaging Het
Prr14l A G 5: 32,829,254 S966P probably damaging Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Serpina3n C A 12: 104,411,357 Q290K probably benign Het
Sft2d1 A G 17: 8,320,637 K91E possibly damaging Het
Slc25a16 T C 10: 62,928,326 V54A probably benign Het
Svep1 A G 4: 58,069,249 Y2846H possibly damaging Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Uty A G Y: 1,151,956 S795P possibly damaging Het
Xrcc5 T A 1: 72,330,030 S348T possibly damaging Het
Other mutations in Gm12666
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01373:Gm12666 APN 4 92191625 missense probably damaging 0.98
IGL01670:Gm12666 APN 4 92191500 splice site probably null
IGL02690:Gm12666 APN 4 92191011 missense probably damaging 0.98
IGL03052:Gm12666 UTSW 4 92191050 missense probably benign 0.01
R2094:Gm12666 UTSW 4 92191656 missense probably damaging 1.00
R2567:Gm12666 UTSW 4 92191323 missense probably benign 0.10
R3438:Gm12666 UTSW 4 92191682 missense possibly damaging 0.94
R3439:Gm12666 UTSW 4 92191682 missense possibly damaging 0.94
R4710:Gm12666 UTSW 4 92190975 missense possibly damaging 0.94
R5810:Gm12666 UTSW 4 92191583 critical splice donor site probably null
R6969:Gm12666 UTSW 4 92191589 missense probably damaging 1.00
R7486:Gm12666 UTSW 4 92191269 missense probably benign 0.11
X0067:Gm12666 UTSW 4 92191334 splice site probably null
Z1177:Gm12666 UTSW 4 92191236 missense possibly damaging 0.50
Z1177:Gm12666 UTSW 4 92191703 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTTGTAACCTTACTGCCATGCATG -3'
(R):5'- AGTGCTTACTTAGAGTGGCCAAG -3'

Sequencing Primer
(F):5'- CCATGCATGGTACCTCTGC -3'
(R):5'- GCTTACTTAGAGTGGCCAAGTAAAC -3'
Posted On2015-07-06