Incidental Mutation 'R4388:Hgf'
ID326297
Institutional Source Beutler Lab
Gene Symbol Hgf
Ensembl Gene ENSMUSG00000028864
Gene Namehepatocyte growth factor
SynonymsHGF/SF, NK1, C230052L06Rik, scatter factor, NK2, SF/HGF
MMRRC Submission 041125-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4388 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location16553495-16620152 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 16614943 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 557 (H557Q)
Ref Sequence ENSEMBL: ENSMUSP00000143424 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030683] [ENSMUST00000196645] [ENSMUST00000199581]
Predicted Effect probably benign
Transcript: ENSMUST00000030683
AA Change: H557Q

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000030683
Gene: ENSMUSG00000028864
AA Change: H557Q

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196645
AA Change: H552Q

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000142517
Gene: ENSMUSG00000028864
AA Change: H552Q

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 204 3.76e-42 SMART
KR 205 286 9.04e-45 SMART
KR 299 381 7.35e-45 SMART
KR 385 467 1.02e-38 SMART
Tryp_SPc 490 714 5.6e-55 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199581
AA Change: H557Q

PolyPhen 2 Score 0.122 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000143424
Gene: ENSMUSG00000028864
AA Change: H557Q

DomainStartEndE-ValueType
low complexity region 7 25 N/A INTRINSIC
PAN_AP 38 123 6.47e-13 SMART
KR 127 209 3.03e-46 SMART
KR 210 291 9.04e-45 SMART
KR 304 386 7.35e-45 SMART
KR 390 472 1.02e-38 SMART
Tryp_SPc 495 719 5.6e-55 SMART
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 86% (31/36)
MGI Phenotype FUNCTION: This gene encodes a protein that binds to the hepatocyte growth factor receptor to regulate cell growth, cell motility and morphogenesis in numerous cell and tissue types. The encoded preproprotein is proteolytically processed to generate multiple protein products, including the hepatocyte growth factor alpha and beta chains, which heterodimerize to form the mature active protein. Although this protein is a member of the peptidase S1 family of serine proteases, it lacks peptidase activity. Homozygous knockout mice for this gene exhibit embryonic lethality due to impaired development of the placenta and liver. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygotes for targeted null mutations exhibit reduced embryonic livers, impaired migration of dermomyotome precursors affecting skeletal muscle formation, defective navigation of hypoglossal motor axons, abnormal placentas, and prenatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,574 probably null Het
Adgrv1 T C 13: 81,581,709 T218A probably damaging Het
Aldh1l2 T C 10: 83,513,622 D254G probably damaging Het
Arpc4 A G 6: 113,385,497 D36G probably damaging Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cldn20 G A 17: 3,533,210 M219I probably benign Het
Dmxl2 G A 9: 54,396,267 P2308S probably damaging Het
Fancd2 A G 6: 113,556,368 I549V probably damaging Het
Galnt2 T C 8: 124,295,453 probably null Het
Galnt9 A G 5: 110,588,391 D191G probably damaging Het
Gm12666 A T 4: 92,191,114 S157T probably benign Het
Ifna12 T C 4: 88,603,109 D67G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Itih1 A G 14: 30,941,555 V164A possibly damaging Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Kmt2b A C 7: 30,588,590 probably benign Het
Kmt2d C T 15: 98,853,626 probably benign Het
Kng1 T A 16: 23,079,318 H489Q possibly damaging Het
Map4k5 C A 12: 69,845,809 M115I probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Naca T C 10: 128,044,792 S1898P probably damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Pex26 A G 6: 121,184,392 D43G probably damaging Het
Prr14l A G 5: 32,829,254 S966P probably damaging Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Serpina3n C A 12: 104,411,357 Q290K probably benign Het
Sft2d1 A G 17: 8,320,637 K91E possibly damaging Het
Slc25a16 T C 10: 62,928,326 V54A probably benign Het
Svep1 A G 4: 58,069,249 Y2846H possibly damaging Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Uty A G Y: 1,151,956 S795P possibly damaging Het
Xrcc5 T A 1: 72,330,030 S348T possibly damaging Het
Other mutations in Hgf
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00333:Hgf APN 5 16611882 missense possibly damaging 0.70
IGL00427:Hgf APN 5 16578486 missense probably benign 0.09
IGL00788:Hgf APN 5 16598230 missense probably damaging 0.99
IGL01290:Hgf APN 5 16604846 missense probably damaging 1.00
IGL01333:Hgf APN 5 16576941 nonsense probably null
IGL01568:Hgf APN 5 16564814 missense probably damaging 1.00
IGL02314:Hgf APN 5 16572602 missense probably damaging 0.99
IGL02328:Hgf APN 5 16598221 missense probably damaging 1.00
IGL02368:Hgf APN 5 16564794 missense possibly damaging 0.95
IGL02486:Hgf APN 5 16602289 missense probably damaging 1.00
IGL02654:Hgf APN 5 16561051 missense probably benign
Foiegras UTSW 5 16615802 missense probably benign 0.01
PIT4378001:Hgf UTSW 5 16611862 missense probably damaging 1.00
R0708:Hgf UTSW 5 16566763 nonsense probably null
R0710:Hgf UTSW 5 16566763 nonsense probably null
R0718:Hgf UTSW 5 16593859 missense probably damaging 1.00
R0967:Hgf UTSW 5 16593841 splice site probably benign
R1181:Hgf UTSW 5 16618925 missense probably damaging 1.00
R1589:Hgf UTSW 5 16613785 missense probably damaging 1.00
R1705:Hgf UTSW 5 16615802 missense probably benign 0.01
R1983:Hgf UTSW 5 16561012 missense possibly damaging 0.53
R2021:Hgf UTSW 5 16576921 missense probably benign
R2441:Hgf UTSW 5 16604790 missense probably damaging 0.99
R4083:Hgf UTSW 5 16615858 nonsense probably null
R4084:Hgf UTSW 5 16615858 nonsense probably null
R4211:Hgf UTSW 5 16614993 missense probably damaging 0.99
R4394:Hgf UTSW 5 16618951 nonsense probably null
R4575:Hgf UTSW 5 16572601 missense probably benign
R5044:Hgf UTSW 5 16614894 missense probably benign 0.00
R5319:Hgf UTSW 5 16566862 critical splice donor site probably null
R5585:Hgf UTSW 5 16564801 missense possibly damaging 0.93
R5700:Hgf UTSW 5 16610124 missense probably damaging 1.00
R5814:Hgf UTSW 5 16602307 missense probably benign 0.19
R6125:Hgf UTSW 5 16598161 missense probably damaging 1.00
R6749:Hgf UTSW 5 16613642 splice site probably null
R6891:Hgf UTSW 5 16604922 critical splice donor site probably null
R6962:Hgf UTSW 5 16615754 missense probably benign 0.32
R7251:Hgf UTSW 5 16593944 missense possibly damaging 0.95
R7296:Hgf UTSW 5 16564843 missense probably benign 0.39
R7463:Hgf UTSW 5 16578450 missense probably benign 0.00
R7470:Hgf UTSW 5 16618856 missense probably benign 0.02
R7630:Hgf UTSW 5 16598250 missense probably benign 0.01
R7807:Hgf UTSW 5 16577011 missense probably damaging 0.99
R8098:Hgf UTSW 5 16561061 missense probably benign 0.04
R8120:Hgf UTSW 5 16613781 missense probably damaging 1.00
R8132:Hgf UTSW 5 16602331 missense probably damaging 1.00
X0024:Hgf UTSW 5 16604828 missense probably damaging 1.00
Z1088:Hgf UTSW 5 16618919 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACCTGTGGTGTTCAGAATCTCTC -3'
(R):5'- CCAGGATTGCAGGTCTGAAAAG -3'

Sequencing Primer
(F):5'- CTCTCTGAACAAATGTGTTG -3'
(R):5'- TTGGTTTTTACACACACACACAC -3'
Posted On2015-07-06