Incidental Mutation 'R4388:Itih1'
ID326318
Institutional Source Beutler Lab
Gene Symbol Itih1
Ensembl Gene ENSMUSG00000006529
Gene Nameinter-alpha trypsin inhibitor, heavy chain 1
Synonymsinter-alpha (globulin) inhibitor, H1 polypeptide, Itih-1, Intin1
MMRRC Submission 041125-MU
Accession Numbers

Genbank: NM_008406.3; Ensembl: ENSMUST00000163118

Is this an essential gene? Probably non essential (E-score: 0.076) question?
Stock #R4388 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location30929180-30943289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 30941555 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 164 (V164A)
Ref Sequence ENSEMBL: ENSMUSP00000126449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006704] [ENSMUST00000163118]
Predicted Effect possibly damaging
Transcript: ENSMUST00000006704
AA Change: V168A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000006704
Gene: ENSMUSG00000006529
AA Change: V168A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 167 6e-79 SMART
low complexity region 240 251 N/A INTRINSIC
VWA 291 472 2.1e-32 SMART
Blast:VWA 528 577 5e-21 BLAST
Pfam:ITI_HC_C 706 892 2.1e-65 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000163118
AA Change: V164A

PolyPhen 2 Score 0.934 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000126449
Gene: ENSMUSG00000006529
AA Change: V164A

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
VIT 34 163 2.44e-80 SMART
low complexity region 236 247 N/A INTRINSIC
VWA 287 468 3.43e-30 SMART
Blast:VWA 524 573 5e-21 BLAST
Pfam:ITI_HC_C 701 888 5.3e-81 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166913
Predicted Effect noncoding transcript
Transcript: ENSMUST00000227938
Meta Mutation Damage Score 0.1677 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency 86% (31/36)
MGI Phenotype FUNCTION: This gene encodes a heavy chain of inter-alpha trypsin inhibitor (IaI) family of plasma serine protease inhibitors. IaI proteins are protein-glycosaminoglycan-protein complexes comprised of two heavy chains and a light chain. The encoded protein covalently associates with the light chain via a chondroitin sulfate moiety. Intravenous administration of the encoded protein improved survival of mice after infection with Escherichia coli. This gene is located adjacent to two other IaI heavy chain genes. Alternative splicing results in multiple transcript variants encoding different isoforms that may undergo similar proteolytic processing to generate mature protein. [provided by RefSeq, Oct 2015]
Allele List at MGI

All alleles(2) : Targeted, other(2)

Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,316,574 probably null Het
Adgrv1 T C 13: 81,581,709 T218A probably damaging Het
Aldh1l2 T C 10: 83,513,622 D254G probably damaging Het
Arpc4 A G 6: 113,385,497 D36G probably damaging Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cldn20 G A 17: 3,533,210 M219I probably benign Het
Dmxl2 G A 9: 54,396,267 P2308S probably damaging Het
Fancd2 A G 6: 113,556,368 I549V probably damaging Het
Galnt2 T C 8: 124,295,453 probably null Het
Galnt9 A G 5: 110,588,391 D191G probably damaging Het
Gm12666 A T 4: 92,191,114 S157T probably benign Het
Hgf T A 5: 16,614,943 H557Q probably benign Het
Ifna12 T C 4: 88,603,109 D67G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Kmt2b A C 7: 30,588,590 probably benign Het
Kmt2d C T 15: 98,853,626 probably benign Het
Kng1 T A 16: 23,079,318 H489Q possibly damaging Het
Map4k5 C A 12: 69,845,809 M115I probably damaging Het
Muc4 T C 16: 32,753,802 I1226T probably benign Het
Naca T C 10: 128,044,792 S1898P probably damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Pex26 A G 6: 121,184,392 D43G probably damaging Het
Prr14l A G 5: 32,829,254 S966P probably damaging Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Serpina3n C A 12: 104,411,357 Q290K probably benign Het
Sft2d1 A G 17: 8,320,637 K91E possibly damaging Het
Slc25a16 T C 10: 62,928,326 V54A probably benign Het
Svep1 A G 4: 58,069,249 Y2846H possibly damaging Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Uty A G Y: 1,151,956 S795P possibly damaging Het
Xrcc5 T A 1: 72,330,030 S348T possibly damaging Het
Other mutations in Itih1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00095:Itih1 APN 14 30929821 missense probably benign 0.26
IGL00227:Itih1 APN 14 30942889 splice site probably null
IGL00902:Itih1 APN 14 30932482 splice site probably benign
IGL02194:Itih1 APN 14 30930365 missense probably benign 0.01
IGL02221:Itih1 APN 14 30929587 missense probably damaging 1.00
IGL02292:Itih1 APN 14 30933355 splice site probably null
IGL02733:Itih1 APN 14 30936720 missense probably damaging 1.00
IGL02928:Itih1 APN 14 30937758 missense probably damaging 1.00
IGL03064:Itih1 APN 14 30941557 missense probably benign 0.09
1mM(1):Itih1 UTSW 14 30929850 missense probably damaging 1.00
R0092:Itih1 UTSW 14 30940863 splice site probably benign
R0647:Itih1 UTSW 14 30935863 missense probably damaging 1.00
R0662:Itih1 UTSW 14 30933360 missense possibly damaging 0.63
R0744:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R0833:Itih1 UTSW 14 30941555 missense probably damaging 1.00
R1070:Itih1 UTSW 14 30942456 splice site probably benign
R1397:Itih1 UTSW 14 30929905 splice site probably benign
R1797:Itih1 UTSW 14 30929899 missense probably damaging 1.00
R1898:Itih1 UTSW 14 30932287 missense probably benign
R1964:Itih1 UTSW 14 30929623 missense probably damaging 1.00
R1967:Itih1 UTSW 14 30941984 missense possibly damaging 0.67
R2086:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R2155:Itih1 UTSW 14 30938071 missense probably damaging 1.00
R2156:Itih1 UTSW 14 30933475 missense possibly damaging 0.88
R2225:Itih1 UTSW 14 30929577 missense possibly damaging 0.88
R3836:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3837:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R3839:Itih1 UTSW 14 30935828 missense probably damaging 1.00
R4504:Itih1 UTSW 14 30935885 missense probably damaging 1.00
R4618:Itih1 UTSW 14 30929831 missense probably benign 0.33
R4682:Itih1 UTSW 14 30937843 missense probably damaging 1.00
R4856:Itih1 UTSW 14 30936701 critical splice donor site probably null
R4886:Itih1 UTSW 14 30936701 critical splice donor site probably null
R5169:Itih1 UTSW 14 30933446 nonsense probably null
R5773:Itih1 UTSW 14 30935399 missense possibly damaging 0.89
R5875:Itih1 UTSW 14 30929530 missense probably benign
R6048:Itih1 UTSW 14 30929823 missense possibly damaging 0.89
R6077:Itih1 UTSW 14 30929876 missense possibly damaging 0.75
R6175:Itih1 UTSW 14 30931195 missense probably damaging 1.00
R6228:Itih1 UTSW 14 30931260 missense probably benign 0.00
R6664:Itih1 UTSW 14 30933436 missense probably damaging 1.00
R6675:Itih1 UTSW 14 30929841 missense possibly damaging 0.50
R7059:Itih1 UTSW 14 30931309 missense possibly damaging 0.93
R7168:Itih1 UTSW 14 30934107 missense probably null 0.98
R7408:Itih1 UTSW 14 30943160 missense probably benign 0.00
R7458:Itih1 UTSW 14 30943266 start codon destroyed probably null
R7717:Itih1 UTSW 14 30931185 missense probably damaging 1.00
R8016:Itih1 UTSW 14 30935294 missense probably damaging 0.96
R8035:Itih1 UTSW 14 30942525 missense probably benign 0.25
Z1177:Itih1 UTSW 14 30929572 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- AGAGGGCTGAACCATTGCTG -3'
(R):5'- CTTGAGTAAGCCTGTCTAAGCTGG -3'

Sequencing Primer
(F):5'- CATTGCTGAAAGCCACAGTTG -3'
(R):5'- CCTGTCTAAGCTGGCATCTGG -3'
Posted On2015-07-06