Incidental Mutation 'R4389:Orc2'
ID326326
Institutional Source Beutler Lab
Gene Symbol Orc2
Ensembl Gene ENSMUSG00000026037
Gene Nameorigin recognition complex, subunit 2
SynonymsOrc2l
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R4389 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location58462771-58505109 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58474861 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 332 (D332G)
Ref Sequence ENSEMBL: ENSMUSP00000027198 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027198] [ENSMUST00000114325] [ENSMUST00000114337]
Predicted Effect probably benign
Transcript: ENSMUST00000027198
AA Change: D332G

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000027198
Gene: ENSMUSG00000026037
AA Change: D332G

DomainStartEndE-ValueType
low complexity region 176 201 N/A INTRINSIC
Pfam:ORC2 254 563 2.5e-110 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114325
AA Change: D284G

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000109964
Gene: ENSMUSG00000026037
AA Change: D284G

DomainStartEndE-ValueType
low complexity region 128 153 N/A INTRINSIC
Pfam:ORC2 206 517 1.2e-108 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000114337
SMART Domains Protein: ENSMUSP00000109976
Gene: ENSMUSG00000026036

DomainStartEndE-ValueType
Pfam:NIF3 31 324 4e-61 PFAM
Meta Mutation Damage Score 0.1871 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The origin recognition complex (ORC) is a highly conserved six subunits protein complex essential for the initiation of the DNA replication in eukaryotic cells. Studies in yeast demonstrated that ORC binds specifically to origins of replication and serves as a platform for the assembly of additional initiation factors such as Cdc6 and Mcm proteins. The protein encoded by this gene is a subunit of the ORC complex. This protein forms a core complex with ORC3, -4, and -5. It also interacts with CDC45 and MCM10, which are proteins known to be important for the initiation of DNA replication. This protein has been demonstrated to specifically associate with the origin of replication of Epstein-Barr virus in human cells, and is thought to be required for DNA replication from viral origin of replication. Alternatively spliced transcript variants have been found, one of which is a nonsense-mediated mRNA decay candidate. [provided by RefSeq, Oct 2010]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Orc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Orc2 APN 1 58493716 missense possibly damaging 0.81
IGL00549:Orc2 APN 1 58481042 missense probably benign 0.00
IGL01343:Orc2 APN 1 58492855 critical splice donor site probably null
IGL01357:Orc2 APN 1 58497392 missense probably benign 0.26
IGL01357:Orc2 APN 1 58497393 missense probably benign 0.00
IGL02167:Orc2 APN 1 58483639 unclassified probably benign
IGL02343:Orc2 APN 1 58469666 critical splice donor site probably null
IGL02548:Orc2 APN 1 58466122 unclassified probably benign
R0557:Orc2 UTSW 1 58469687 missense probably damaging 1.00
R1470:Orc2 UTSW 1 58481158 unclassified probably benign
R1886:Orc2 UTSW 1 58471088 critical splice acceptor site probably null
R2065:Orc2 UTSW 1 58469695 missense probably damaging 1.00
R3848:Orc2 UTSW 1 58480992 missense probably benign 0.08
R4393:Orc2 UTSW 1 58467650 critical splice donor site probably null
R4613:Orc2 UTSW 1 58500309 nonsense probably null
R5183:Orc2 UTSW 1 58474818 missense possibly damaging 0.83
R5652:Orc2 UTSW 1 58466072 missense probably damaging 0.99
R5793:Orc2 UTSW 1 58497388 start codon destroyed probably null 0.27
R5997:Orc2 UTSW 1 58472388 missense probably damaging 1.00
R6007:Orc2 UTSW 1 58467692 missense probably benign 0.03
R6330:Orc2 UTSW 1 58500334 missense probably benign
R6656:Orc2 UTSW 1 58493659 critical splice donor site probably null
R6923:Orc2 UTSW 1 58500375 missense probably benign 0.01
R6934:Orc2 UTSW 1 58500364 missense probably benign 0.28
R7354:Orc2 UTSW 1 58469747 missense possibly damaging 0.96
R7718:Orc2 UTSW 1 58480317 missense possibly damaging 0.65
R7950:Orc2 UTSW 1 58467668 missense possibly damaging 0.64
Z1088:Orc2 UTSW 1 58476516 missense probably benign
Predicted Primers PCR Primer
(F):5'- TAAGTGGTCTGAAGCCTAAAGC -3'
(R):5'- GGGGCTGCTCTTTGTACATTACC -3'

Sequencing Primer
(F):5'- CTATAACAGTTAAGGGGCCA -3'
(R):5'- ACATTACCCTTTGTTCTTTGGGG -3'
Posted On2015-07-06