Incidental Mutation 'R4389:Zfp189'
ID326328
Institutional Source Beutler Lab
Gene Symbol Zfp189
Ensembl Gene ENSMUSG00000039634
Gene Namezinc finger protein 189
SynonymsC430015I23Rik
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4389 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location49521176-49531517 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 49529934 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Glycine at position 346 (R346G)
Ref Sequence ENSEMBL: ENSMUSP00000103324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042964] [ENSMUST00000107696]
Predicted Effect probably damaging
Transcript: ENSMUST00000042964
AA Change: R346G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000036663
Gene: ENSMUSG00000039634
AA Change: R346G

DomainStartEndE-ValueType
KRAB 11 61 1.98e-4 SMART
ZnF_C2H2 130 152 1.58e-3 SMART
ZnF_C2H2 158 180 1.47e-3 SMART
ZnF_C2H2 186 208 1.84e-4 SMART
ZnF_C2H2 214 236 2.43e-4 SMART
ZnF_C2H2 242 264 2.61e-4 SMART
ZnF_C2H2 270 292 2.75e-3 SMART
ZnF_C2H2 298 320 1.56e-2 SMART
ZnF_C2H2 326 348 7.26e-3 SMART
ZnF_C2H2 354 376 1.72e-4 SMART
ZnF_C2H2 382 404 3.21e-4 SMART
ZnF_C2H2 438 460 3.95e-4 SMART
ZnF_C2H2 466 488 1.12e-3 SMART
ZnF_C2H2 494 516 1.18e-2 SMART
ZnF_C2H2 522 544 4.24e-4 SMART
ZnF_C2H2 550 572 2.79e-4 SMART
ZnF_C2H2 581 603 2.05e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107696
AA Change: R346G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103324
Gene: ENSMUSG00000039634
AA Change: R346G

DomainStartEndE-ValueType
KRAB 11 61 1.98e-4 SMART
ZnF_C2H2 130 152 1.58e-3 SMART
ZnF_C2H2 158 180 1.47e-3 SMART
ZnF_C2H2 186 208 1.84e-4 SMART
ZnF_C2H2 214 236 2.43e-4 SMART
ZnF_C2H2 242 264 2.61e-4 SMART
ZnF_C2H2 270 292 2.75e-3 SMART
ZnF_C2H2 298 320 1.56e-2 SMART
ZnF_C2H2 326 348 7.26e-3 SMART
ZnF_C2H2 354 376 1.72e-4 SMART
ZnF_C2H2 382 404 3.21e-4 SMART
ZnF_C2H2 438 460 3.95e-4 SMART
ZnF_C2H2 466 488 1.12e-3 SMART
ZnF_C2H2 494 516 1.18e-2 SMART
ZnF_C2H2 522 544 4.24e-4 SMART
ZnF_C2H2 550 572 2.79e-4 SMART
ZnF_C2H2 581 603 2.05e-2 SMART
Meta Mutation Damage Score 0.3779 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Kruppel-like zinc finger proteins such as ZNF189 contain a conserved stretch of 7 amino acids that connects a variable number of DNA-binding zinc finger repeats of the cys(2)his(2) (C2H2) type (summarized by Odeberg et al., 1998 [PubMed 9653648]). Approximately 30% of human Kruppel-like zinc finger proteins contain an N-terminal Kruppel-associated box (KRAB) domain. The KRAB domain consists of approximately 75 amino acids that may be subdivided into an A box, which is present in every KRAB domain and is essential for transcriptional repression, and a B box, which is not always present.[supplied by OMIM, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Other mutations in Zfp189
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02075:Zfp189 APN 4 49522445 missense probably damaging 0.98
R1754:Zfp189 UTSW 4 49529342 missense possibly damaging 0.87
R1848:Zfp189 UTSW 4 49529266 missense probably benign 0.01
R1868:Zfp189 UTSW 4 49529283 missense possibly damaging 0.90
R1903:Zfp189 UTSW 4 49529511 nonsense probably null
R2247:Zfp189 UTSW 4 49530393 missense possibly damaging 0.95
R2889:Zfp189 UTSW 4 49521547 start gained probably benign
R4659:Zfp189 UTSW 4 49530342 missense probably benign 0.33
R4704:Zfp189 UTSW 4 49530081 missense probably damaging 0.98
R4840:Zfp189 UTSW 4 49529984 missense probably damaging 1.00
R4920:Zfp189 UTSW 4 49529302 missense probably damaging 0.98
R5011:Zfp189 UTSW 4 49530438 missense probably damaging 1.00
R5013:Zfp189 UTSW 4 49530438 missense probably damaging 1.00
R5522:Zfp189 UTSW 4 49529739 nonsense probably null
R5639:Zfp189 UTSW 4 49530153 missense probably benign 0.01
R6814:Zfp189 UTSW 4 49529026 missense probably damaging 0.99
R7372:Zfp189 UTSW 4 49530417 missense possibly damaging 0.95
R7491:Zfp189 UTSW 4 49521569 missense probably benign 0.06
R7680:Zfp189 UTSW 4 49521547 start gained probably benign
R7800:Zfp189 UTSW 4 49529367 missense possibly damaging 0.95
R8023:Zfp189 UTSW 4 49530312 missense probably damaging 1.00
R8320:Zfp189 UTSW 4 49530180 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CGCAAGGCCCATTTCATTC -3'
(R):5'- TGAGCACTGACACTGAACG -3'

Sequencing Primer
(F):5'- AGGCCTTACCAGTGTAATCAGTG -3'
(R):5'- GGAGACTTCCTGCTGTATAACCAG -3'
Posted On2015-07-06