Incidental Mutation 'R4389:Mtfr1l'
ID326330
Institutional Source Beutler Lab
Gene Symbol Mtfr1l
Ensembl Gene ENSMUSG00000046671
Gene Namemitochondrial fission regulator 1-like
SynonymsFam54b, 2410166I05Rik
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R4389 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location134525550-134535387 bp(-) (GRCm38)
Type of Mutationutr 5 prime
DNA Base Change (assembly) T to C at 134532642 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117943 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102550] [ENSMUST00000116279] [ENSMUST00000131613] [ENSMUST00000146808] [ENSMUST00000154769]
Predicted Effect probably benign
Transcript: ENSMUST00000102550
SMART Domains Protein: ENSMUSP00000099609
Gene: ENSMUSG00000046671

DomainStartEndE-ValueType
Pfam:Mito_fiss_reg 7 251 4.9e-71 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000116279
SMART Domains Protein: ENSMUSP00000111983
Gene: ENSMUSG00000046671

DomainStartEndE-ValueType
Pfam:Mito_fiss_reg 7 251 4.9e-71 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129836
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130187
Predicted Effect probably benign
Transcript: ENSMUST00000131613
SMART Domains Protein: ENSMUSP00000123326
Gene: ENSMUSG00000046671

DomainStartEndE-ValueType
Pfam:Mito_fiss_reg 5 201 2.3e-69 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146808
SMART Domains Protein: ENSMUSP00000120200
Gene: ENSMUSG00000046671

DomainStartEndE-ValueType
Pfam:Mito_fiss_reg 5 225 1.5e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154769
SMART Domains Protein: ENSMUSP00000117943
Gene: ENSMUSG00000046671

DomainStartEndE-ValueType
Pfam:Mito_fiss_reg 5 237 1.5e-84 PFAM
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Mtfr1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01011:Mtfr1l APN 4 134529200 missense probably damaging 0.97
IGL01868:Mtfr1l APN 4 134530707 missense probably null 1.00
IGL02218:Mtfr1l APN 4 134529180 missense probably benign 0.39
IGL02338:Mtfr1l APN 4 134530743 missense probably damaging 1.00
IGL02454:Mtfr1l APN 4 134530385 missense probably damaging 1.00
IGL03102:Mtfr1l APN 4 134532232 missense probably damaging 0.99
R1183:Mtfr1l UTSW 4 134529125 missense probably damaging 1.00
R6620:Mtfr1l UTSW 4 134529083 splice site probably null
R7363:Mtfr1l UTSW 4 134529266 missense probably benign 0.09
Z1176:Mtfr1l UTSW 4 134530679 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTAGAATTAGCAGGTGGTATGGC -3'
(R):5'- CCTTTAACCATTGGCGGTGC -3'

Sequencing Primer
(F):5'- GTATGGCTGTTCTGGCTCCC -3'
(R):5'- CGGTGCTGGTTTTAGTAATGGC -3'
Posted On2015-07-06