Incidental Mutation 'R4389:Vmn1r66'
ID326333
Institutional Source Beutler Lab
Gene Symbol Vmn1r66
Ensembl Gene ENSMUSG00000043066
Gene Namevomeronasal 1 receptor 66
SynonymsV1re11
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.078) question?
Stock #R4389 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location10272991-10278006 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 10274788 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 106 (L106*)
Ref Sequence ENSEMBL: ENSMUSP00000153860 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060374] [ENSMUST00000227719] [ENSMUST00000228086] [ENSMUST00000228622]
Predicted Effect probably null
Transcript: ENSMUST00000060374
AA Change: L106*
SMART Domains Protein: ENSMUSP00000055861
Gene: ENSMUSG00000043066
AA Change: L106*

DomainStartEndE-ValueType
Pfam:V1R 39 295 4.5e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226202
Predicted Effect probably null
Transcript: ENSMUST00000227719
AA Change: L106*
Predicted Effect probably null
Transcript: ENSMUST00000228086
AA Change: L106*
Predicted Effect probably null
Transcript: ENSMUST00000228622
AA Change: L106*
Meta Mutation Damage Score 0.9653 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Vmn1r66
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02957:Vmn1r66 APN 7 10274810 missense probably damaging 1.00
IGL03236:Vmn1r66 APN 7 10275063 missense probably damaging 0.98
R0380:Vmn1r66 UTSW 7 10274743 missense probably benign 0.02
R1625:Vmn1r66 UTSW 7 10274389 missense probably benign 0.00
R3745:Vmn1r66 UTSW 7 10274321 missense possibly damaging 0.64
R4081:Vmn1r66 UTSW 7 10274806 missense probably damaging 1.00
R5081:Vmn1r66 UTSW 7 10274795 missense probably damaging 1.00
R5909:Vmn1r66 UTSW 7 10274342 missense probably benign 0.44
R6164:Vmn1r66 UTSW 7 10274402 nonsense probably null
R6792:Vmn1r66 UTSW 7 10274485 missense possibly damaging 0.78
R6843:Vmn1r66 UTSW 7 10274765 missense probably damaging 1.00
R7013:Vmn1r66 UTSW 7 10274756 missense possibly damaging 0.94
R7173:Vmn1r66 UTSW 7 10274555 missense probably benign 0.00
R7400:Vmn1r66 UTSW 7 10274947 missense probably damaging 0.99
Z1176:Vmn1r66 UTSW 7 10274285 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CACTAATGCTGCATAAACTGAGTG -3'
(R):5'- TTGATTCTCATGCACCTCTGGG -3'

Sequencing Primer
(F):5'- TGGTTAACATAGGAGCAGTACTC -3'
(R):5'- GGAGCCAATGCCTTGATAGTTC -3'
Posted On2015-07-06