Incidental Mutation 'R4389:Adprm'
ID326339
Institutional Source Beutler Lab
Gene Symbol Adprm
Ensembl Gene ENSMUSG00000020910
Gene NameADP-ribose/CDP-alcohol diphosphatase, manganese dependent
Synonyms
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4389 (G1)
Quality Score191
Status Validated
Chromosome11
Chromosomal Location67037905-67052594 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 67038193 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Lysine at position 324 (R324K)
Ref Sequence ENSEMBL: ENSMUSP00000112064 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061786] [ENSMUST00000079077] [ENSMUST00000116363] [ENSMUST00000146338]
Predicted Effect probably benign
Transcript: ENSMUST00000061786
SMART Domains Protein: ENSMUSP00000057366
Gene: ENSMUSG00000050270

DomainStartEndE-ValueType
Pfam:TMEM220 23 122 4e-30 PFAM
transmembrane domain 127 149 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079077
SMART Domains Protein: ENSMUSP00000078084
Gene: ENSMUSG00000050270

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:TMEM220 23 48 1.2e-9 PFAM
Pfam:TMEM220 64 144 4.3e-19 PFAM
transmembrane domain 151 173 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000116363
AA Change: R324K

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112064
Gene: ENSMUSG00000020910
AA Change: R324K

DomainStartEndE-ValueType
Pfam:Metallophos 18 282 1.8e-12 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127407
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136013
Predicted Effect probably benign
Transcript: ENSMUST00000146338
SMART Domains Protein: ENSMUSP00000137768
Gene: ENSMUSG00000020910

DomainStartEndE-ValueType
PDB:2NXF|A 13 199 4e-47 PDB
SCOP:d1utea_ 15 176 3e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146648
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148379
Meta Mutation Damage Score 0.0577 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Tec A G 5: 72,782,007 Y222H probably benign Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Adprm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02668:Adprm APN 11 67040247 missense possibly damaging 0.86
R0179:Adprm UTSW 11 67038225 missense possibly damaging 0.79
R1493:Adprm UTSW 11 67041876 missense possibly damaging 0.95
R1636:Adprm UTSW 11 67041723 missense possibly damaging 0.91
R1999:Adprm UTSW 11 67038229 missense probably benign 0.03
R2085:Adprm UTSW 11 67041852 missense probably damaging 1.00
R2150:Adprm UTSW 11 67038229 missense probably benign 0.03
R4387:Adprm UTSW 11 67038193 missense probably benign 0.00
R4995:Adprm UTSW 11 67041610 missense possibly damaging 0.95
R5015:Adprm UTSW 11 67042030 missense possibly damaging 0.95
R7250:Adprm UTSW 11 67041624 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CTTCACTCACACATACTCAAGGTG -3'
(R):5'- GTGGATGCTCTGTCAATCATATGG -3'

Sequencing Primer
(F):5'- CATACTCAAGGTGCAAATACATTTTG -3'
(R):5'- CTGTCAATCATATGGTCTCACAAGTG -3'
Posted On2015-07-06