Incidental Mutation 'R0013:Mboat7'
ID32634
Institutional Source Beutler Lab
Gene Symbol Mboat7
Ensembl Gene ENSMUSG00000035596
Gene Namemembrane bound O-acyltransferase domain containing 7
SynonymsLeng4, mBB1, Lpiat1, 5730589L02Rik
MMRRC Submission 038308-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.679) question?
Stock #R0013 (G1)
Quality Score207
Status Validated
Chromosome7
Chromosomal Location3677789-3693523 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3683822 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 340 (S340P)
Ref Sequence ENSEMBL: ENSMUSP00000037107 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038608] [ENSMUST00000118710] [ENSMUST00000127106] [ENSMUST00000128364] [ENSMUST00000206343] [ENSMUST00000206379] [ENSMUST00000206571]
Predicted Effect probably damaging
Transcript: ENSMUST00000038608
AA Change: S340P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000037107
Gene: ENSMUSG00000035596
AA Change: S340P

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Pfam:MBOAT 57 420 2.4e-37 PFAM
transmembrane domain 425 447 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118710
SMART Domains Protein: ENSMUSP00000112710
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
transmembrane domain 35 57 N/A INTRINSIC
Pfam:MBOAT 86 343 1.5e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127106
SMART Domains Protein: ENSMUSP00000116446
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
transmembrane domain 5 22 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000128364
SMART Domains Protein: ENSMUSP00000120521
Gene: ENSMUSG00000035596

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 32 46 N/A INTRINSIC
low complexity region 58 67 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131688
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133223
Predicted Effect probably benign
Transcript: ENSMUST00000206343
Predicted Effect probably benign
Transcript: ENSMUST00000206379
Predicted Effect probably benign
Transcript: ENSMUST00000206571
Meta Mutation Damage Score 0.4157 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.8%
Validation Efficiency 94% (79/84)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the membrane-bound O-acyltransferases family of integral membrane proteins that have acyltransferase activity. The encoded protein is a lysophosphatidylinositol acyltransferase that has specificity for arachidonoyl-CoA as an acyl donor. This protein is involved in the reacylation of phospholipids as part of the phospholipid remodeling pathway known as the Land cycle. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2009]
PHENOTYPE: Mice homozygous for a targeted mutation exhibit hydrocephaly and most die between 1-3 months of age. Mice homozygous for a knock-out allele exhibit partial lethality with decreased body size, decreased forebrain size, delayed neuronal migrationand reduced neurite outgrowth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610028H24Rik A G 10: 76,457,512 M156V probably benign Het
Adnp2 A T 18: 80,129,745 V483D probably damaging Het
Aff1 G T 5: 103,828,484 E491* probably null Het
Agl A T 3: 116,776,608 C911* probably null Het
Akt2 A G 7: 27,636,058 D284G probably damaging Het
Alox15 A G 11: 70,349,635 M240T possibly damaging Het
Antxr2 A G 5: 97,979,985 V229A probably damaging Het
Arap2 G A 5: 62,683,484 L680F probably damaging Het
Btaf1 A G 19: 36,958,373 T188A probably benign Het
Btnl6 G A 17: 34,515,531 Q86* probably null Het
C2cd3 T A 7: 100,416,062 L685H probably damaging Het
Cdh23 T C 10: 60,413,173 T878A possibly damaging Het
Clec4b2 T C 6: 123,202,149 Y137H probably damaging Het
Dchs1 T A 7: 105,755,836 T2500S possibly damaging Het
Def6 A G 17: 28,217,092 Y75C probably damaging Het
Dhx33 A T 11: 70,993,635 F448L probably damaging Het
Dner C T 1: 84,494,893 probably benign Het
Dnmbp G A 19: 43,902,231 P366S probably benign Het
Eif4g3 T C 4: 138,175,848 C1160R possibly damaging Het
Elmod1 G A 9: 53,912,901 probably benign Het
Faah C A 4: 116,004,391 L305F probably damaging Het
Fam71b A G 11: 46,406,804 T312A unknown Het
Flt1 A G 5: 147,571,014 probably benign Het
Fyco1 A T 9: 123,822,406 N1196K probably benign Het
Galnt18 T C 7: 111,554,457 N320S probably damaging Het
Glp2r C A 11: 67,709,712 G437V possibly damaging Het
Gm4884 T C 7: 41,044,292 S562P probably damaging Het
Gm9936 A G 5: 114,857,347 probably benign Het
Gpn2 C A 4: 133,584,792 P112T probably damaging Het
Grm4 A G 17: 27,431,575 Y816H probably benign Het
Helz2 A T 2: 181,240,959 S14T probably benign Het
Htt T C 5: 34,820,104 L778P probably benign Het
Il11ra1 T C 4: 41,765,060 S129P probably damaging Het
Ints11 T C 4: 155,887,168 F315S probably damaging Het
Itga11 A T 9: 62,776,613 N1059Y possibly damaging Het
Jak3 A G 8: 71,684,327 S716G probably damaging Het
Kcns1 G T 2: 164,168,643 D65E probably benign Het
Kdm5d A T Y: 941,715 K1305N probably benign Het
Kif26a G T 12: 112,177,880 V1523L probably benign Het
Mctp2 T C 7: 72,229,408 I234V probably benign Het
Mex3c G A 18: 73,590,551 A572T probably benign Het
Mpp3 C A 11: 102,005,425 R424L probably benign Het
Mroh4 T A 15: 74,608,237 probably benign Het
Myo9a A T 9: 59,860,206 probably benign Het
Myog T A 1: 134,290,235 H60Q probably damaging Het
Nlrp9a T A 7: 26,571,225 probably null Het
Notch1 A G 2: 26,473,818 V868A possibly damaging Het
Olfr352 A G 2: 36,870,160 N198S probably damaging Het
Olfr59 T A 11: 74,289,051 I135N possibly damaging Het
Olfr73 T C 2: 88,034,266 Y291C possibly damaging Het
Olfr980 A T 9: 40,006,355 I198N probably damaging Het
Pink1 T C 4: 138,317,401 T342A probably benign Het
Plb1 T A 5: 32,349,615 probably benign Het
Plec T C 15: 76,178,246 D2524G probably damaging Het
Plekhg4 G T 8: 105,375,396 E6* probably null Het
Polq T C 16: 37,061,839 F1455S possibly damaging Het
Ppm1e A G 11: 87,249,058 probably benign Het
Prkaca G A 8: 83,988,303 M119I possibly damaging Het
Prss46 G T 9: 110,850,055 S108I probably damaging Het
Ptma C T 1: 86,529,776 probably benign Het
Rab11fip4 C T 11: 79,689,653 T437M probably benign Het
Rngtt T A 4: 33,379,409 M437K probably benign Het
Rrn3 T A 16: 13,813,113 D604E possibly damaging Het
Scn4a A G 11: 106,348,405 probably benign Het
Sis A G 3: 72,910,476 L1468P possibly damaging Het
Slit3 A G 11: 35,707,918 M1450V probably benign Het
Smg5 T C 3: 88,349,233 S269P probably benign Het
Sntg1 T C 1: 8,463,462 T323A probably damaging Het
Son C T 16: 91,651,662 T37I probably damaging Het
Stk17b T C 1: 53,764,132 I41M probably benign Het
Tgm5 T A 2: 121,076,882 Y120F probably damaging Het
Tppp A G 13: 74,021,360 K73R possibly damaging Het
Ttn C A 2: 76,739,158 K27130N probably damaging Het
Ttn C T 2: 76,907,752 V4148I probably benign Het
Uba7 A T 9: 107,978,249 Y375F probably damaging Het
Ugcg T C 4: 59,213,931 L171P possibly damaging Het
Vsig2 T C 9: 37,542,576 probably benign Het
Zcchc11 T A 4: 108,530,955 probably benign Het
Zfp839 T A 12: 110,868,386 S692T possibly damaging Het
Other mutations in Mboat7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02234:Mboat7 APN 7 3691351 missense probably damaging 1.00
IGL02550:Mboat7 APN 7 3683906 splice site probably null
R0013:Mboat7 UTSW 7 3683822 missense probably damaging 1.00
R0046:Mboat7 UTSW 7 3683818 missense probably damaging 1.00
R0046:Mboat7 UTSW 7 3683818 missense probably damaging 1.00
R1649:Mboat7 UTSW 7 3685818 missense probably benign 0.06
R2036:Mboat7 UTSW 7 3685672 critical splice donor site probably null
R2091:Mboat7 UTSW 7 3684011 unclassified probably benign
R3031:Mboat7 UTSW 7 3678688 missense probably benign
R4200:Mboat7 UTSW 7 3685753 missense possibly damaging 0.56
R4382:Mboat7 UTSW 7 3688546 missense possibly damaging 0.53
R5407:Mboat7 UTSW 7 3691381 missense probably damaging 1.00
R6181:Mboat7 UTSW 7 3683885 missense probably benign 0.44
R6785:Mboat7 UTSW 7 3685836 missense probably benign 0.42
RF013:Mboat7 UTSW 7 3691857 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCCCAGAGGATTTACCTCAGAG -3'
(R):5'- TAGTGAATTGTGCCCCACCTACCC -3'

Sequencing Primer
(F):5'- TCCATAAGCCTTGGGCCTTA -3'
(R):5'- ccccatcctcatctccacc -3'
Posted On2013-05-09